ID: 1200535374

View in Genome Browser
Species Human (GRCh38)
Location Y:4390561-4390583
Sequence AACTACGTGGGGTCTTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535374_1200535381 10 Left 1200535374 Y:4390561-4390583 CCTTGCCAAGACCCCACGTAGTT No data
Right 1200535381 Y:4390594-4390616 GACTGACAGCCTTCATGGAGTGG No data
1200535374_1200535384 21 Left 1200535374 Y:4390561-4390583 CCTTGCCAAGACCCCACGTAGTT No data
Right 1200535384 Y:4390605-4390627 TTCATGGAGTGGATTCATGAGGG No data
1200535374_1200535380 5 Left 1200535374 Y:4390561-4390583 CCTTGCCAAGACCCCACGTAGTT No data
Right 1200535380 Y:4390589-4390611 TGTCAGACTGACAGCCTTCATGG No data
1200535374_1200535385 22 Left 1200535374 Y:4390561-4390583 CCTTGCCAAGACCCCACGTAGTT No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535374_1200535383 20 Left 1200535374 Y:4390561-4390583 CCTTGCCAAGACCCCACGTAGTT No data
Right 1200535383 Y:4390604-4390626 CTTCATGGAGTGGATTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535374 Original CRISPR AACTACGTGGGGTCTTGGCA AGG (reversed) Intergenic