ID: 1200535375

View in Genome Browser
Species Human (GRCh38)
Location Y:4390566-4390588
Sequence CACGGAACTACGTGGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535375_1200535381 5 Left 1200535375 Y:4390566-4390588 CCAAGACCCCACGTAGTTCCGTG No data
Right 1200535381 Y:4390594-4390616 GACTGACAGCCTTCATGGAGTGG No data
1200535375_1200535380 0 Left 1200535375 Y:4390566-4390588 CCAAGACCCCACGTAGTTCCGTG No data
Right 1200535380 Y:4390589-4390611 TGTCAGACTGACAGCCTTCATGG No data
1200535375_1200535385 17 Left 1200535375 Y:4390566-4390588 CCAAGACCCCACGTAGTTCCGTG No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535375_1200535384 16 Left 1200535375 Y:4390566-4390588 CCAAGACCCCACGTAGTTCCGTG No data
Right 1200535384 Y:4390605-4390627 TTCATGGAGTGGATTCATGAGGG No data
1200535375_1200535383 15 Left 1200535375 Y:4390566-4390588 CCAAGACCCCACGTAGTTCCGTG No data
Right 1200535383 Y:4390604-4390626 CTTCATGGAGTGGATTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535375 Original CRISPR CACGGAACTACGTGGGGTCT TGG (reversed) Intergenic
No off target data available for this crispr