ID: 1200535377

View in Genome Browser
Species Human (GRCh38)
Location Y:4390573-4390595
Sequence TCTGACACACGGAACTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535377_1200535383 8 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535383 Y:4390604-4390626 CTTCATGGAGTGGATTCATGAGG No data
1200535377_1200535384 9 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535384 Y:4390605-4390627 TTCATGGAGTGGATTCATGAGGG No data
1200535377_1200535387 27 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data
1200535377_1200535385 10 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535377_1200535381 -2 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535381 Y:4390594-4390616 GACTGACAGCCTTCATGGAGTGG No data
1200535377_1200535386 26 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535386 Y:4390622-4390644 TGAGGGGATCTCCTATTTCAAGG No data
1200535377_1200535380 -7 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535380 Y:4390589-4390611 TGTCAGACTGACAGCCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535377 Original CRISPR TCTGACACACGGAACTACGT GGG (reversed) Intergenic