ID: 1200535378

View in Genome Browser
Species Human (GRCh38)
Location Y:4390574-4390596
Sequence GTCTGACACACGGAACTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535378_1200535387 26 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data
1200535378_1200535383 7 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535383 Y:4390604-4390626 CTTCATGGAGTGGATTCATGAGG No data
1200535378_1200535381 -3 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535381 Y:4390594-4390616 GACTGACAGCCTTCATGGAGTGG No data
1200535378_1200535385 9 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535378_1200535384 8 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535384 Y:4390605-4390627 TTCATGGAGTGGATTCATGAGGG No data
1200535378_1200535386 25 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535386 Y:4390622-4390644 TGAGGGGATCTCCTATTTCAAGG No data
1200535378_1200535380 -8 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535380 Y:4390589-4390611 TGTCAGACTGACAGCCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535378 Original CRISPR GTCTGACACACGGAACTACG TGG (reversed) Intergenic