ID: 1200535379

View in Genome Browser
Species Human (GRCh38)
Location Y:4390584-4390606
Sequence AAGGCTGTCAGTCTGACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535379_1200535383 -3 Left 1200535379 Y:4390584-4390606 CCGTGTGTCAGACTGACAGCCTT No data
Right 1200535383 Y:4390604-4390626 CTTCATGGAGTGGATTCATGAGG No data
1200535379_1200535386 15 Left 1200535379 Y:4390584-4390606 CCGTGTGTCAGACTGACAGCCTT No data
Right 1200535386 Y:4390622-4390644 TGAGGGGATCTCCTATTTCAAGG No data
1200535379_1200535384 -2 Left 1200535379 Y:4390584-4390606 CCGTGTGTCAGACTGACAGCCTT No data
Right 1200535384 Y:4390605-4390627 TTCATGGAGTGGATTCATGAGGG No data
1200535379_1200535385 -1 Left 1200535379 Y:4390584-4390606 CCGTGTGTCAGACTGACAGCCTT No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535379_1200535387 16 Left 1200535379 Y:4390584-4390606 CCGTGTGTCAGACTGACAGCCTT No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535379 Original CRISPR AAGGCTGTCAGTCTGACACA CGG (reversed) Intergenic
No off target data available for this crispr