ID: 1200535382

View in Genome Browser
Species Human (GRCh38)
Location Y:4390603-4390625
Sequence CTCATGAATCCACTCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535382_1200535386 -4 Left 1200535382 Y:4390603-4390625 CCTTCATGGAGTGGATTCATGAG No data
Right 1200535386 Y:4390622-4390644 TGAGGGGATCTCCTATTTCAAGG No data
1200535382_1200535389 24 Left 1200535382 Y:4390603-4390625 CCTTCATGGAGTGGATTCATGAG No data
Right 1200535389 Y:4390650-4390672 AAAGATCCATGAGAGAAGTGTGG 0: 4
1: 31
2: 66
3: 200
4: 553
1200535382_1200535387 -3 Left 1200535382 Y:4390603-4390625 CCTTCATGGAGTGGATTCATGAG No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535382 Original CRISPR CTCATGAATCCACTCCATGA AGG (reversed) Intergenic
No off target data available for this crispr