ID: 1200535385

View in Genome Browser
Species Human (GRCh38)
Location Y:4390606-4390628
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535377_1200535385 10 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535376_1200535385 11 Left 1200535376 Y:4390572-4390594 CCCCACGTAGTTCCGTGTGTCAG No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535378_1200535385 9 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535375_1200535385 17 Left 1200535375 Y:4390566-4390588 CCAAGACCCCACGTAGTTCCGTG No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535374_1200535385 22 Left 1200535374 Y:4390561-4390583 CCTTGCCAAGACCCCACGTAGTT No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data
1200535379_1200535385 -1 Left 1200535379 Y:4390584-4390606 CCGTGTGTCAGACTGACAGCCTT No data
Right 1200535385 Y:4390606-4390628 TCATGGAGTGGATTCATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535385 Original CRISPR TCATGGAGTGGATTCATGAG GGG Intergenic