ID: 1200535387

View in Genome Browser
Species Human (GRCh38)
Location Y:4390623-4390645
Sequence GAGGGGATCTCCTATTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535376_1200535387 28 Left 1200535376 Y:4390572-4390594 CCCCACGTAGTTCCGTGTGTCAG No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data
1200535378_1200535387 26 Left 1200535378 Y:4390574-4390596 CCACGTAGTTCCGTGTGTCAGAC No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data
1200535379_1200535387 16 Left 1200535379 Y:4390584-4390606 CCGTGTGTCAGACTGACAGCCTT No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data
1200535377_1200535387 27 Left 1200535377 Y:4390573-4390595 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data
1200535382_1200535387 -3 Left 1200535382 Y:4390603-4390625 CCTTCATGGAGTGGATTCATGAG No data
Right 1200535387 Y:4390623-4390645 GAGGGGATCTCCTATTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535387 Original CRISPR GAGGGGATCTCCTATTTCAA GGG Intergenic
No off target data available for this crispr