ID: 1200540014

View in Genome Browser
Species Human (GRCh38)
Location Y:4447109-4447131
Sequence AACTGGCAACAGAGGTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200540011_1200540014 6 Left 1200540011 Y:4447080-4447102 CCTAGAACAAAAACAGTGTGCAA No data
Right 1200540014 Y:4447109-4447131 AACTGGCAACAGAGGTATCCAGG No data
1200540010_1200540014 9 Left 1200540010 Y:4447077-4447099 CCACCTAGAACAAAAACAGTGTG No data
Right 1200540014 Y:4447109-4447131 AACTGGCAACAGAGGTATCCAGG No data
1200540009_1200540014 10 Left 1200540009 Y:4447076-4447098 CCCACCTAGAACAAAAACAGTGT No data
Right 1200540014 Y:4447109-4447131 AACTGGCAACAGAGGTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200540014 Original CRISPR AACTGGCAACAGAGGTATCC AGG Intergenic
No off target data available for this crispr