ID: 1200545034

View in Genome Browser
Species Human (GRCh38)
Location Y:4509202-4509224
Sequence CTTTTCTCGGCAGCCTCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200545030_1200545034 28 Left 1200545030 Y:4509151-4509173 CCACAGAGGCTGAACTAATTTAC No data
Right 1200545034 Y:4509202-4509224 CTTTTCTCGGCAGCCTCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200545034 Original CRISPR CTTTTCTCGGCAGCCTCGCC AGG Intergenic