ID: 1200548179

View in Genome Browser
Species Human (GRCh38)
Location Y:4544218-4544240
Sequence GACAGATGCTAGCAGTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200548177_1200548179 -9 Left 1200548177 Y:4544204-4544226 CCTTGCTCTTAGAAGACAGATGC No data
Right 1200548179 Y:4544218-4544240 GACAGATGCTAGCAGTATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200548179 Original CRISPR GACAGATGCTAGCAGTATTA GGG Intergenic
No off target data available for this crispr