ID: 1200549275

View in Genome Browser
Species Human (GRCh38)
Location Y:4558599-4558621
Sequence GCAGTCTGGGGTATTGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200549270_1200549275 -3 Left 1200549270 Y:4558579-4558601 CCCACGAAGAGTGAGCAAAAGCA No data
Right 1200549275 Y:4558599-4558621 GCAGTCTGGGGTATTGCCTCAGG No data
1200549271_1200549275 -4 Left 1200549271 Y:4558580-4558602 CCACGAAGAGTGAGCAAAAGCAG No data
Right 1200549275 Y:4558599-4558621 GCAGTCTGGGGTATTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200549275 Original CRISPR GCAGTCTGGGGTATTGCCTC AGG Intergenic
No off target data available for this crispr