ID: 1200551557

View in Genome Browser
Species Human (GRCh38)
Location Y:4584491-4584513
Sequence AGAGATCTAACATGGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200551557_1200551564 28 Left 1200551557 Y:4584491-4584513 CCCCACCACCATGTTAGATCTCT No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200551557 Original CRISPR AGAGATCTAACATGGTGGTG GGG (reversed) Intergenic
No off target data available for this crispr