ID: 1200551559

View in Genome Browser
Species Human (GRCh38)
Location Y:4584493-4584515
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200551559_1200551564 26 Left 1200551559 Y:4584493-4584515 CCACCACCATGTTAGATCTCTGT No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200551559 Original CRISPR ACAGAGATCTAACATGGTGG TGG (reversed) Intergenic
No off target data available for this crispr