ID: 1200551563

View in Genome Browser
Species Human (GRCh38)
Location Y:4584523-4584545
Sequence ACACAAATTCACATCAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200551563_1200551565 6 Left 1200551563 Y:4584523-4584545 CCAATTCTGATGTGAATTTGTGT No data
Right 1200551565 Y:4584552-4584574 TGTATGCCCATGGATCCTCCAGG No data
1200551563_1200551572 23 Left 1200551563 Y:4584523-4584545 CCAATTCTGATGTGAATTTGTGT No data
Right 1200551572 Y:4584569-4584591 TCCAGGCTGGAATCATGGATGGG No data
1200551563_1200551564 -4 Left 1200551563 Y:4584523-4584545 CCAATTCTGATGTGAATTTGTGT No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data
1200551563_1200551566 10 Left 1200551563 Y:4584523-4584545 CCAATTCTGATGTGAATTTGTGT No data
Right 1200551566 Y:4584556-4584578 TGCCCATGGATCCTCCAGGCTGG No data
1200551563_1200551571 22 Left 1200551563 Y:4584523-4584545 CCAATTCTGATGTGAATTTGTGT No data
Right 1200551571 Y:4584568-4584590 CTCCAGGCTGGAATCATGGATGG No data
1200551563_1200551569 18 Left 1200551563 Y:4584523-4584545 CCAATTCTGATGTGAATTTGTGT No data
Right 1200551569 Y:4584564-4584586 GATCCTCCAGGCTGGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200551563 Original CRISPR ACACAAATTCACATCAGAAT TGG (reversed) Intergenic
No off target data available for this crispr