ID: 1200551564

View in Genome Browser
Species Human (GRCh38)
Location Y:4584542-4584564
Sequence GTGTTTGAGTTGTATGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200551557_1200551564 28 Left 1200551557 Y:4584491-4584513 CCCCACCACCATGTTAGATCTCT No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data
1200551558_1200551564 27 Left 1200551558 Y:4584492-4584514 CCCACCACCATGTTAGATCTCTG No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data
1200551562_1200551564 -3 Left 1200551562 Y:4584522-4584544 CCCAATTCTGATGTGAATTTGTG No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data
1200551559_1200551564 26 Left 1200551559 Y:4584493-4584515 CCACCACCATGTTAGATCTCTGT No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data
1200551560_1200551564 23 Left 1200551560 Y:4584496-4584518 CCACCATGTTAGATCTCTGTAGT No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data
1200551563_1200551564 -4 Left 1200551563 Y:4584523-4584545 CCAATTCTGATGTGAATTTGTGT No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data
1200551561_1200551564 20 Left 1200551561 Y:4584499-4584521 CCATGTTAGATCTCTGTAGTCAT No data
Right 1200551564 Y:4584542-4584564 GTGTTTGAGTTGTATGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200551564 Original CRISPR GTGTTTGAGTTGTATGCCCA TGG Intergenic
No off target data available for this crispr