ID: 1200551565

View in Genome Browser
Species Human (GRCh38)
Location Y:4584552-4584574
Sequence TGTATGCCCATGGATCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200551561_1200551565 30 Left 1200551561 Y:4584499-4584521 CCATGTTAGATCTCTGTAGTCAT No data
Right 1200551565 Y:4584552-4584574 TGTATGCCCATGGATCCTCCAGG No data
1200551563_1200551565 6 Left 1200551563 Y:4584523-4584545 CCAATTCTGATGTGAATTTGTGT No data
Right 1200551565 Y:4584552-4584574 TGTATGCCCATGGATCCTCCAGG No data
1200551562_1200551565 7 Left 1200551562 Y:4584522-4584544 CCCAATTCTGATGTGAATTTGTG No data
Right 1200551565 Y:4584552-4584574 TGTATGCCCATGGATCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200551565 Original CRISPR TGTATGCCCATGGATCCTCC AGG Intergenic
No off target data available for this crispr