ID: 1200555403

View in Genome Browser
Species Human (GRCh38)
Location Y:4631184-4631206
Sequence GGACCTGCCCTGAGACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200555403_1200555406 14 Left 1200555403 Y:4631184-4631206 CCTCTCTGTCTCAGGGCAGGTCC No data
Right 1200555406 Y:4631221-4631243 AGAGTCAAGTCCTGAAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200555403 Original CRISPR GGACCTGCCCTGAGACAGAG AGG (reversed) Intergenic
No off target data available for this crispr