ID: 1200557954

View in Genome Browser
Species Human (GRCh38)
Location Y:4661383-4661405
Sequence TCTTCTATTGCACCTCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200557953_1200557954 21 Left 1200557953 Y:4661339-4661361 CCATTTGTGTAATAGTAAAGATG No data
Right 1200557954 Y:4661383-4661405 TCTTCTATTGCACCTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200557954 Original CRISPR TCTTCTATTGCACCTCAAAC TGG Intergenic
No off target data available for this crispr