ID: 1200564551

View in Genome Browser
Species Human (GRCh38)
Location Y:4749132-4749154
Sequence CAGGACTTTCCCTGGTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200564551_1200564557 25 Left 1200564551 Y:4749132-4749154 CCTACAAACCAGGGAAAGTCCTG No data
Right 1200564557 Y:4749180-4749202 CTACCAAACGTATAAAGACCTGG No data
1200564551_1200564558 26 Left 1200564551 Y:4749132-4749154 CCTACAAACCAGGGAAAGTCCTG No data
Right 1200564558 Y:4749181-4749203 TACCAAACGTATAAAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200564551 Original CRISPR CAGGACTTTCCCTGGTTTGT AGG (reversed) Intergenic
No off target data available for this crispr