ID: 1200569149

View in Genome Browser
Species Human (GRCh38)
Location Y:4805976-4805998
Sequence TCATAAGCACAGATGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200569149_1200569153 19 Left 1200569149 Y:4805976-4805998 CCAAGTGCCATCTGTGCTTATGA No data
Right 1200569153 Y:4806018-4806040 ACATTTCCATGATTATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200569149 Original CRISPR TCATAAGCACAGATGGCACT TGG (reversed) Intergenic
No off target data available for this crispr