ID: 1200572617

View in Genome Browser
Species Human (GRCh38)
Location Y:4852277-4852299
Sequence GACTCACAGTTCCACAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20276
Summary {0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200572617 Original CRISPR GACTCACAGTTCCACAGGAC TGG Intergenic
Too many off-targets to display for this crispr