ID: 1200585352

View in Genome Browser
Species Human (GRCh38)
Location Y:5000614-5000636
Sequence CCCTGTACAGGTACCCAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200585352_1200585357 -9 Left 1200585352 Y:5000614-5000636 CCGGACTGGGTACCTGTACAGGG 0: 2
1: 0
2: 0
3: 1
4: 69
Right 1200585357 Y:5000628-5000650 TGTACAGGGTGCTGTCAGGGAGG 0: 2
1: 0
2: 1
3: 12
4: 199
1200585352_1200585358 -2 Left 1200585352 Y:5000614-5000636 CCGGACTGGGTACCTGTACAGGG 0: 2
1: 0
2: 0
3: 1
4: 69
Right 1200585358 Y:5000635-5000657 GGTGCTGTCAGGGAGGCGTGAGG 0: 2
1: 0
2: 2
3: 27
4: 338
1200585352_1200585359 16 Left 1200585352 Y:5000614-5000636 CCGGACTGGGTACCTGTACAGGG 0: 2
1: 0
2: 0
3: 1
4: 69
Right 1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG 0: 2
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200585352 Original CRISPR CCCTGTACAGGTACCCAGTC CGG (reversed) Intronic
901450943 1:9336857-9336879 CCCTGTCCAGAGACCCAGGCGGG + Intronic
914735722 1:150414522-150414544 TCATGTATAGGTAGCCAGTCTGG - Intronic
919907441 1:202087501-202087523 CCTTGTACTGTTACCCAGGCTGG + Intergenic
922875545 1:228937201-228937223 CCCTGCAGAGGTACCAAGCCCGG + Intergenic
1070777666 10:79119224-79119246 CCATGTCCAGGTCCCAAGTCAGG - Intronic
1071383766 10:85099036-85099058 GCCTGTGCAGTTACCCAGTGGGG - Intergenic
1074107303 10:110398229-110398251 CCCGGTTCAGTTACTCAGTCAGG + Intergenic
1074240284 10:111632067-111632089 CCCTGCACAGGTCCCCCGGCAGG - Intergenic
1075320394 10:121486904-121486926 CCCTGTGGAGGTCCCCAGCCTGG + Intronic
1076600797 10:131655685-131655707 CCCTGCACAGGGAGCCACTCTGG + Intergenic
1083504336 11:63141550-63141572 CCTTGTACAGGGACTCTGTCTGG - Intronic
1090293446 11:125566533-125566555 CCAAGTACAGGTACCCAGAAAGG - Intergenic
1102288597 12:111680399-111680421 CCCGGCACAGGTAGCCATTCTGG - Intronic
1103210009 12:119158694-119158716 CCCTGCCCAGGAACCCAGACTGG + Exonic
1103245388 12:119452471-119452493 CAATGCAAAGGTACCCAGTCTGG - Intronic
1107129955 13:36884625-36884647 TCCTGTACTGTTACCCAGCCGGG - Intronic
1112226835 13:97547783-97547805 CCCTCACCAGGAACCCAGTCTGG - Intergenic
1119547211 14:75480514-75480536 CCTTGTGCAGGAGCCCAGTCAGG - Intergenic
1122745333 14:103894316-103894338 CCCTGCACACCTACCCAGCCCGG - Intergenic
1122789438 14:104178185-104178207 CCCTGCACAGGTCGCCAGGCTGG + Intronic
1125767904 15:42147313-42147335 CACTCTACAGGGACCCAGCCTGG - Exonic
1132864133 16:2085337-2085359 CCCTGTCCAGGCACCTAGGCCGG - Intronic
1135694596 16:24575274-24575296 CTCTGTCCAGCTGCCCAGTCTGG - Intergenic
1136599671 16:31276661-31276683 CTCTTTACAGGTACTCAGACAGG + Exonic
1139549044 16:67663402-67663424 CCCTGCCCAGGTACTCACTCTGG + Exonic
1140306325 16:73806504-73806526 CCTTGTACAGATACACAGTCAGG + Intergenic
1142114343 16:88348556-88348578 CCCTGTACAGCTCCCCCGTGTGG - Intergenic
1144377668 17:14661618-14661640 CCCTGTGTAGGTACACAGTGTGG - Intergenic
1146441495 17:32899432-32899454 CCCTGTACAGGTCTTCAGCCAGG - Intergenic
1147061100 17:37879169-37879191 CACTGCACAGTTACCCAGCCTGG + Intergenic
1163981874 19:20908396-20908418 CCATGAACAGGTACCCAATGTGG - Intergenic
1164528314 19:29027914-29027936 CGCTGTCCTGGCACCCAGTCCGG - Intergenic
1165041355 19:33070110-33070132 GCCTGTCCAGGGACCCAGTTGGG + Intergenic
1165578163 19:36838986-36839008 CCCTATAGGGGTACCCTGTCTGG + Intronic
1165725591 19:38110441-38110463 CCCTGTACTGGGACCCACTTGGG - Intronic
1166300242 19:41908714-41908736 CCCTTTACTGGTCCCCAGGCAGG - Intronic
1167528369 19:49999687-49999709 CCCTGGAGAGGCTCCCAGTCTGG - Intronic
938767574 2:134470561-134470583 CCCTGTAGAGGAACAGAGTCTGG + Intronic
941181480 2:162264599-162264621 CACAGAACAGGTACCCCGTCTGG - Intergenic
948263432 2:236621098-236621120 CCCTGGACAGATCCCCTGTCTGG - Intergenic
1178638305 21:34324651-34324673 TCCTGGACAGATACCCACTCTGG + Intergenic
1179238557 21:39568442-39568464 CCCAGGACAGGGACCCAGGCAGG - Intronic
1181010708 22:20038843-20038865 CCTCGTACAGGTACCCAGCTAGG + Intronic
1181431995 22:22887572-22887594 CAGTGTACAGGCACCCAGCCTGG + Intronic
1182651470 22:31854809-31854831 CCCTGTAAACTTACACAGTCTGG - Intronic
1183689242 22:39378988-39379010 CTCTGTACAGGAAACCAGCCTGG + Intronic
1184190454 22:42891170-42891192 CCCTGCACAGGGCCCCAGTACGG - Exonic
961833207 3:129635347-129635369 CCCTGCCCAGGTTCCCAATCAGG + Intergenic
968711017 4:2117681-2117703 CCCTCAACACCTACCCAGTCAGG - Intronic
969430259 4:7149827-7149849 CCCTGGGCAGGTGCCCAGCCAGG + Intergenic
974875507 4:67699160-67699182 CCAGGTACAGGGAACCAGTCTGG + Intronic
976497578 4:85748070-85748092 CCCTCTACAGGTTCCCTGTAAGG + Intronic
978347221 4:107784403-107784425 CCATGGACCAGTACCCAGTCTGG - Intergenic
983979445 4:173976169-173976191 CCCTCTACAGGAGCTCAGTCTGG + Intergenic
996254234 5:121378711-121378733 CCCAGTACAAGTTCCCTGTCCGG - Intergenic
997248432 5:132370568-132370590 CCCTGCACAGGTGGTCAGTCTGG + Intronic
997481004 5:134184469-134184491 TCCTGTCCAGAAACCCAGTCTGG + Intronic
1002935957 6:1672676-1672698 TTCTGGAAAGGTACCCAGTCTGG - Intronic
1005429703 6:25742330-25742352 TCCTGCCCAGGTTCCCAGTCAGG - Intergenic
1007654314 6:43443092-43443114 CCCTCTCCAGGTACTCAGTGCGG - Exonic
1013911217 6:115278478-115278500 CTCTATACAGGCACCCAGCCAGG - Intergenic
1014671771 6:124313498-124313520 CCCAGTACAGGTGCCTAGGCTGG + Intronic
1023800650 7:43831357-43831379 CCTTGTACAGGCACCCTGTGTGG - Intergenic
1029348195 7:99993804-99993826 CCCAGTGCAGATCCCCAGTCTGG + Intergenic
1032668205 7:134059101-134059123 CCTTGGACAGTTCCCCAGTCAGG + Intronic
1033502923 7:141971840-141971862 TCCTGCACAGGAACCCAGCCAGG - Intronic
1043323930 8:79026328-79026350 CTCTGTACAGCTACCCTCTCTGG - Intergenic
1054812077 9:69442895-69442917 CCCTGCTCAGGTACCCTGCCTGG + Intronic
1056688495 9:88786157-88786179 CTCTGAACAGGCACCCAGACTGG + Intergenic
1057195216 9:93112674-93112696 CCCTCTACTGGCACCCAGCCTGG + Intronic
1194268151 X:91779693-91779715 CCCTGTACAGGTACCCAGTCCGG - Intronic
1200585352 Y:5000614-5000636 CCCTGTACAGGTACCCAGTCCGG - Intronic