ID: 1200585356

View in Genome Browser
Species Human (GRCh38)
Location Y:5000626-5000648
Sequence TCCCTGACAGCACCCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200585356_1200585359 4 Left 1200585356 Y:5000626-5000648 CCTGTACAGGGTGCTGTCAGGGA 0: 2
1: 0
2: 0
3: 9
4: 160
Right 1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG 0: 2
1: 0
2: 0
3: 5
4: 47
1200585356_1200585361 30 Left 1200585356 Y:5000626-5000648 CCTGTACAGGGTGCTGTCAGGGA 0: 2
1: 0
2: 0
3: 9
4: 160
Right 1200585361 Y:5000679-5000701 CTGCCCGCTGCCTGCCCCTGAGG 0: 2
1: 0
2: 7
3: 53
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200585356 Original CRISPR TCCCTGACAGCACCCTGTAC AGG (reversed) Intronic
900001230 1:15929-15951 TCCCTGGGAGCTCCCTGGACTGG + Intergenic
900020947 1:186451-186473 TCCCTGGGAGCTCCCTGGACTGG + Intergenic
900120822 1:1047986-1048008 ACCCTAACAGCTCCCTGTGCCGG + Intronic
900784862 1:4642699-4642721 ACCCTGACAGCACCTTGTTTTGG + Intergenic
903951541 1:26998637-26998659 TCCTTGACTGCACCCTGGCCAGG + Intronic
904087279 1:27917789-27917811 TCCCTGACAGCCCCCAGTCTGGG - Intergenic
907659354 1:56377818-56377840 ACCCTTACAACACCCTGTAAAGG + Intergenic
908629827 1:66091047-66091069 CCCTTGACAGCACCCTGTTGTGG + Intronic
912470635 1:109904592-109904614 TCCCTGCCAGCTCCCAGTGCTGG - Intergenic
912513292 1:110202566-110202588 TCTCTTACAGGACCCTGTAGGGG + Intergenic
915641451 1:157230271-157230293 TCCCTGACATCACTCTCTCCTGG - Intergenic
915667231 1:157456223-157456245 TCCCTGACATCACTCTCTGCTGG + Intergenic
917595780 1:176527861-176527883 TCCCTGACAGACCTCTGTGCGGG + Intronic
918961327 1:191282236-191282258 TTCCAGACAGCTCTCTGTACTGG - Intergenic
919026336 1:192176022-192176044 TCCCAGAAAGCAGCCTGTCCTGG + Intronic
921046876 1:211484099-211484121 CCCCTGACTGCACTCTGCACAGG + Intronic
922210604 1:223483676-223483698 TGGCTGACAGCACACTGTCCTGG - Intergenic
1063330996 10:5159410-5159432 TTCCTGACACCACCCTCTCCTGG + Intergenic
1064152974 10:12880530-12880552 TCCCTCACAGCACCCTTTTAAGG + Intergenic
1064771090 10:18723609-18723631 TCTGTGACAGCACCCTCTAATGG + Intergenic
1065047111 10:21754461-21754483 TCACTTACAGCACCCTGAATTGG - Intergenic
1065872617 10:29968540-29968562 TCCCTGAGTGCACCCTGCCCTGG - Intergenic
1068721903 10:60254927-60254949 TCCCTCCCAGCACCAGGTACTGG + Intronic
1070703336 10:78619040-78619062 TCCCAGAGAGGCCCCTGTACAGG - Intergenic
1070844122 10:79507928-79507950 TCCCAGACAACACCCGGTAGAGG + Intergenic
1071517635 10:86309572-86309594 TACCTGGCAGCATCCTGTCCTGG + Intronic
1072303277 10:94083158-94083180 TTCCTAACAGCACCCTTTATTGG - Intronic
1076161253 10:128245785-128245807 TCCCTGAGATCCCCCTGCACTGG + Intergenic
1082261148 11:50077014-50077036 TGCATGACAGCAGCCTCTACAGG - Intergenic
1083735268 11:64676498-64676520 TCACTGTCAGCTCCCTGGACAGG - Intronic
1084143872 11:67253028-67253050 TCCCAGGCAGCACTCTGGACTGG + Intronic
1085666674 11:78420295-78420317 TCCCTGGCTGCACCCTGGAGTGG + Intergenic
1085739243 11:79064940-79064962 CCCCTCACGGGACCCTGTACCGG - Exonic
1087637785 11:100722098-100722120 ACACTGACAGCACCATATACTGG - Intronic
1088067199 11:105733846-105733868 TCCATGATATCACACTGTACTGG + Intronic
1089370264 11:117950480-117950502 TCCTTGACGACACCCTCTACCGG - Intergenic
1090745339 11:129700816-129700838 ACCCAGACAGCCCCCTGCACAGG - Intergenic
1091230639 11:133985900-133985922 TCCCCGACAGCTCCCTGTCTTGG - Intergenic
1091374321 12:16047-16069 TCCCTGGGAGCTCCCTGGACTGG + Intergenic
1092007338 12:5080497-5080519 TCCCTGCCAGCTCCCTGAGCTGG + Intergenic
1093384308 12:18532717-18532739 TCTCTGACAGTACCCTGTGGGGG + Intronic
1095439507 12:42227766-42227788 TCCCGGACAGCACGCTGGCCAGG - Intronic
1097182732 12:57180345-57180367 TCCCTGAAAGCAAACTCTACTGG + Exonic
1097998524 12:65916349-65916371 TTCCTGACAGCATGATGTACTGG + Intronic
1102784999 12:115597422-115597444 ACCATGACAACACCCTCTACTGG - Intergenic
1103740103 12:123085291-123085313 TCCCTGGCAGCACCTGGTATAGG + Intronic
1104989117 12:132615179-132615201 ACCCTCACAGCACACTGTAAAGG - Intergenic
1105003657 12:132707641-132707663 TGCCTGACAGCACTCCGTAAAGG - Intergenic
1105843182 13:24272971-24272993 TCCCTGACAGCTCTCTGGGCTGG - Intronic
1114416611 14:22549060-22549082 TCCCTGCCACCACCCTGCCCAGG - Intergenic
1126477353 15:49079652-49079674 TCCAAGACACCACCCTTTACAGG - Intergenic
1127837108 15:62798765-62798787 TCCCTGACAGCACCCATGAGTGG + Intronic
1129673666 15:77620956-77620978 TCCCCCACAGCATCCTCTACAGG + Intronic
1129903936 15:79172830-79172852 CCCCTGACACCACCCTGGACTGG + Intergenic
1129935990 15:79450810-79450832 TGCCTCACAGCACCCTCTGCAGG - Intronic
1130883908 15:88077738-88077760 TCCGTGACAGCTCCAAGTACAGG - Intronic
1132452277 15:101975009-101975031 TCCCTGGGAGCTCCCTGGACTGG - Intergenic
1132855773 16:2043985-2044007 TCCCTGCCAGCACCCAGGCCAGG + Intronic
1132903132 16:2268957-2268979 TCCCTGCCCGGACCCTGCACCGG - Intergenic
1135245938 16:20857240-20857262 TCCCTGACTGCTCCCTTTTCTGG + Exonic
1137657462 16:50172387-50172409 TCCCAGTCAGCACACCGTACAGG - Intronic
1138490926 16:57376219-57376241 TACCTCACAGCACCCAGCACAGG + Intronic
1138564598 16:57824022-57824044 TCCCTGACAGGACTCTGCAAGGG - Intronic
1142324653 16:89406791-89406813 TCCCGGAGGGCACCCTGTCCTGG - Intronic
1142934003 17:3311895-3311917 TCCCTGTCAGCACCCTTTTCAGG - Intergenic
1145005054 17:19332938-19332960 TCCCTGACAGTACCTTGCAGAGG + Intronic
1145827012 17:27884623-27884645 TCCCTGGCAGCACCATGAGCGGG - Intronic
1146486797 17:33249552-33249574 TCCTAGACAGGACCCTGTCCTGG - Intronic
1147332412 17:39706686-39706708 TGCCAGCCAACACCCTGTACTGG + Intronic
1149087084 17:52731050-52731072 TCCCTGACATCTCACTGTTCAGG + Intergenic
1151521771 17:74635414-74635436 TCCCTGACAGCACCTGGCAGGGG - Intergenic
1156528520 18:37792471-37792493 TCCCTCACAGGGCCCTGTACAGG - Intergenic
1160006122 18:75070298-75070320 TCCCTGACGGCTTCCTGCACAGG - Intergenic
1160039772 18:75335097-75335119 ACCCTGCCAGCACCCTGCAGAGG + Intergenic
1161078594 19:2299204-2299226 TCCCCGGCAGCACCCTGCAGAGG - Intronic
1163709790 19:18839842-18839864 GCCCTCACAGCACCCTGGCCAGG - Intronic
1163729060 19:18939542-18939564 GCCCCCACAACACCCTGTACAGG + Exonic
1164801787 19:31083177-31083199 TCCCTGACAGCCCAGTGTCCAGG - Intergenic
1165766464 19:38354572-38354594 TCCCTGACACCACACTGAACGGG + Intronic
1167111678 19:47466269-47466291 CCCCTGGCAGCCCCCTGTGCTGG + Exonic
1168393453 19:56029124-56029146 TCCATCACAGAACCCTCTACTGG - Intronic
926882252 2:17558974-17558996 TCCCTGAAACCACCCTGTCAGGG - Intronic
927506564 2:23618972-23618994 TGCCAGACAGCCCCCTTTACAGG + Intronic
928447883 2:31349145-31349167 TCCCTGAGTGCAACCCGTACTGG + Intronic
930898534 2:56474936-56474958 GCCCTGACAGCATGCTGTCCTGG + Intergenic
931312465 2:61095657-61095679 TCCCCGACAGGACCCTATTCAGG + Intronic
932639277 2:73426733-73426755 TGCATGACAGCTCCCTGCACTGG + Intronic
936568491 2:113597482-113597504 TCCCTGGGAGCTCCCTGGACTGG - Intergenic
938305069 2:130247669-130247691 TGCCTGACAGCAGCCTTTTCTGG + Intergenic
938448944 2:131399538-131399560 TGCCTGACAGCAGCCTTTTCTGG - Intergenic
942620422 2:177839164-177839186 TCCCTGCCATCACCATGTCCTGG + Intronic
946329116 2:218999973-218999995 TCCCTGTCAGCACCCTGGGTGGG - Intergenic
948293025 2:236841563-236841585 TCCCTCACATCACCTTGTAAGGG + Intergenic
948747585 2:240107530-240107552 GCCATGACAGCACCCAGTCCGGG + Intergenic
948761634 2:240195676-240195698 CCCCTGGCAGCAGCTTGTACTGG - Intergenic
948781915 2:240326967-240326989 TCCTTGTCAGCACCCTGACCTGG + Intergenic
1173629602 20:44501673-44501695 TCCCTGACATCACCCCTCACTGG + Intronic
1174285559 20:49470405-49470427 TCCCTGCCACCACCCTCTTCTGG + Intronic
1174566529 20:51468790-51468812 TCCCTGACCCCACACGGTACGGG - Intronic
1174574209 20:51525452-51525474 TGCCTCACTGCATCCTGTACAGG + Intronic
1175520076 20:59596984-59597006 TGCCTGACAGCACACAGGACAGG + Intronic
1175693338 20:61082295-61082317 TCCCTGAGATCACCCTGTTCTGG + Intergenic
1175895054 20:62332468-62332490 CCCCCCACAGCACCCTGTGCCGG - Exonic
1179654521 21:42837179-42837201 TCCCTGCCATCACCCGGTGCTGG - Intergenic
1184863887 22:47192099-47192121 TCCTTGGCAGCAGCCTGGACTGG + Intergenic
1185110009 22:48895537-48895559 TTCCTGACTGCACCCCGGACAGG + Intergenic
1185134818 22:49063578-49063600 TCCCTGAGAGCAGCCTTTTCAGG - Intergenic
1185159039 22:49211760-49211782 TCACTGACACCCCCCTGTCCTGG - Intergenic
951768541 3:26228316-26228338 TTCTTGACAGCACCCTGAGCTGG + Intergenic
953653839 3:44832241-44832263 TCACTGCCAGCACCTTGTATTGG - Intronic
954345328 3:49992525-49992547 TCCCTGAAACCACCCTGCAAAGG + Intronic
954442865 3:50531204-50531226 TCCCTGAAGCCACCCTGTTCAGG - Intergenic
956485292 3:69716223-69716245 TCTCTACCACCACCCTGTACAGG + Intergenic
959915913 3:111816343-111816365 TCCCTCCCAGCTCCCTTTACGGG - Intronic
961208025 3:125102881-125102903 TCCCTGCCAGCACCCTCTCTGGG - Intronic
961632842 3:128313854-128313876 TCCCTGACAACCCCCTGTCTTGG + Intronic
962084394 3:132174688-132174710 TACCTGTCAGCACCGTCTACTGG + Intronic
963722601 3:148879996-148880018 TCCCTGACAGCACCAAGTATGGG - Intronic
972675605 4:41257190-41257212 TCCCTGCCAGCAGCCGGAACCGG - Intronic
973130988 4:46647979-46648001 TCCCTGTCACAACCCTGTCCTGG - Intergenic
976371318 4:84291754-84291776 TCCCTGACAGGCCCCTGTCAGGG - Intergenic
978712325 4:111799557-111799579 TCCCTGCCAGCCCACTGTTCGGG - Intergenic
980967171 4:139533354-139533376 TTCCTCACAGCACCCTGGAGGGG - Exonic
984504205 4:180596149-180596171 TCCCTGCCGACACACTGTACAGG - Intergenic
986332235 5:6726196-6726218 TTCATGACAGCACCATGTAGGGG + Intronic
986439052 5:7762514-7762536 TCCCTTGCACCACCCTGCACAGG - Intronic
991988174 5:72311078-72311100 TTCTAGACAGCATCCTGTACTGG + Intronic
992300337 5:75371667-75371689 TCCCTGACTGCCCACTGTACAGG - Exonic
992616117 5:78547840-78547862 TCCCTCAGACCACCCTGAACAGG - Intronic
992689609 5:79229889-79229911 TCCCTGCCACCACCCTGAAGTGG + Intronic
994630342 5:102277281-102277303 TCTCTGACACCACCCTGGAAGGG - Intronic
994913207 5:105940366-105940388 TCCTTGGAAGCACCCTGTGCTGG - Intergenic
1001530225 5:172456031-172456053 TCACTGACAGCTCTCTGTCCTGG + Intergenic
1002338972 5:178501926-178501948 TCCCTGACACGGCCCTGTAGGGG - Intronic
1006423617 6:33950407-33950429 GCCCCCACAGCACCCTGTAGAGG + Intergenic
1008700941 6:54098518-54098540 TCCCTGACACCATCCTGCCCTGG - Intronic
1018678229 6:166241605-166241627 TTCCTTACAGCACCATGCACAGG + Intergenic
1020514883 7:9106172-9106194 TCACTGACAGCACCCTTCCCTGG + Intergenic
1028019118 7:85749317-85749339 ACCCTGACTGCAGCCTCTACTGG - Intergenic
1029212970 7:98923758-98923780 TCCCTGTCATCACCCTCTCCTGG + Intronic
1029882840 7:103834977-103834999 TGCCTGACAAAAACCTGTACAGG + Intronic
1031502070 7:122531119-122531141 TCAGTGACAGCAAGCTGTACTGG + Intronic
1035193674 7:157196072-157196094 TCTCTGACACCACCCTGGAGAGG - Intronic
1035210674 7:157325823-157325845 TGCCACACAGGACCCTGTACGGG - Intergenic
1036185879 8:6622058-6622080 TCCCTGGCAGCGCCCGGCACTGG + Intronic
1038178285 8:25201816-25201838 TCCCTGACAGTACCCTAGCCTGG + Intronic
1038471565 8:27827747-27827769 TCACTGACATCACCCAATACTGG + Intronic
1042229884 8:66544683-66544705 TCTCTGACATCACCCTGGGCAGG - Intergenic
1045189237 8:99866653-99866675 TGGCTGTCAGCACCCTGTGCGGG + Intronic
1048252962 8:132882535-132882557 TCACTGAAACCACCCTGTACCGG + Exonic
1048553494 8:135455203-135455225 TCCCTGACAGCTGCTTGTAAAGG - Intergenic
1048944727 8:139433902-139433924 TCCCTGTCTGCACCATGTGCTGG - Intergenic
1049014182 8:139908030-139908052 TCCCAGACACCACCCTGGGCTGG - Intronic
1049586316 8:143434189-143434211 TCCTAGACTGCACCCTGGACGGG - Intergenic
1049884038 9:16043-16065 TCCCTGGGAGCTCCCTGGACTGG + Intergenic
1050002302 9:1090769-1090791 TTCTTGACAGTATCCTGTACAGG + Intergenic
1053154899 9:35770658-35770680 TCCATGACACCACACTGTCCAGG - Intergenic
1055074495 9:72199790-72199812 TCCCTGACACCTCTCTGTCCTGG + Intronic
1056487692 9:87075645-87075667 TTCATGAACGCACCCTGTACTGG - Intergenic
1057304235 9:93903165-93903187 TCTGTGACAACACCCTGTGCGGG - Intergenic
1057897088 9:98917814-98917836 TCTCTGACATCCCCCTGTCCTGG + Intergenic
1058047829 9:100375911-100375933 GCCCTGACAAGACCCTGTGCAGG + Intergenic
1060401860 9:123354162-123354184 CCCCCGACAGCACCGGGTACAGG - Intergenic
1062374169 9:136254501-136254523 GACCTGCCAGAACCCTGTACCGG - Intergenic
1189502815 X:41580072-41580094 GCCCTAACTGCACCTTGTACTGG + Intronic
1192150042 X:68706486-68706508 TCCCTGACAGCTCTTAGTACAGG + Intronic
1194268155 X:91779705-91779727 TCCCTGACAGCACCCTGTACAGG - Intronic
1197176768 X:123494463-123494485 TCCATGACAGCACTCTTTACTGG + Intergenic
1198417436 X:136434810-136434832 TCCCTGGCAGCAGCCTTTCCCGG + Intergenic
1200401772 X:156024116-156024138 TCCCTGGGAGCTCCCTGGACTGG - Intergenic
1200585356 Y:5000626-5000648 TCCCTGACAGCACCCTGTACAGG - Intronic