ID: 1200585359

View in Genome Browser
Species Human (GRCh38)
Location Y:5000653-5000675
Sequence TGAGGTCCACACTTAGTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200585356_1200585359 4 Left 1200585356 Y:5000626-5000648 CCTGTACAGGGTGCTGTCAGGGA 0: 2
1: 0
2: 0
3: 9
4: 160
Right 1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG 0: 2
1: 0
2: 0
3: 5
4: 47
1200585352_1200585359 16 Left 1200585352 Y:5000614-5000636 CCGGACTGGGTACCTGTACAGGG 0: 2
1: 0
2: 0
3: 1
4: 69
Right 1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG 0: 2
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200585359 Original CRISPR TGAGGTCCACACTTAGTGCG CGG Intronic
904000547 1:27336182-27336204 TGAGGTCCACACCTGGGGCTGGG - Exonic
905868384 1:41388757-41388779 TGAGGTCCACACTCAGCTTGCGG + Intergenic
913199366 1:116483710-116483732 TGATGGCCACACTGAGTGCTGGG + Intergenic
915460846 1:156069908-156069930 TGAGCTCCAGACTGAGTGGGAGG - Intronic
1071110760 10:82152612-82152634 TGAGGTCCAAATATAGTGAGTGG - Intronic
1073218926 10:101853464-101853486 TGAGGGCCACACTTAGGGAGAGG + Intronic
1079050112 11:17147501-17147523 TGAGGTACACACTTACTGTTCGG + Exonic
1095967309 12:47877721-47877743 TGAGGTCCACACATCCTGCAGGG - Intronic
1096601014 12:52729525-52729547 TGAGGTCCACGCCCAGTACGAGG - Intergenic
1104276519 12:127333587-127333609 TGAGGTCCACACTTGCTGGGAGG - Intergenic
1104607969 12:130203787-130203809 TAAGATACACACGTAGTGCGGGG + Intergenic
1104792465 12:131492689-131492711 TGCTGTCCACCCTCAGTGCGGGG - Intergenic
1105024521 12:132839356-132839378 GGAGGTCCTGAGTTAGTGCGGGG - Intronic
1105024569 12:132839536-132839558 GGAGGTCCTGAGTTAGTGCGGGG - Intronic
1113352213 13:109540418-109540440 TGAGATCCACAGTAAGTGGGCGG + Intergenic
1115951587 14:38727817-38727839 TGAGGTCAAGGCTTAGTACGAGG + Intergenic
1117189865 14:53278911-53278933 TGAGGTCCACAGGGAGTGGGTGG + Intergenic
1118183124 14:63513424-63513446 TGAGAAGCACACTTAGTGAGTGG - Intronic
1122298081 14:100716745-100716767 AGAGATCCACACTCAGTGGGGGG - Intergenic
1124839892 15:33231709-33231731 TGAGGTCAACAATTAGTACAAGG + Intergenic
1125828377 15:42694193-42694215 TGAGTTCCACGCTGAGTGAGAGG - Exonic
1131275706 15:90978824-90978846 TGAGGTCCACCCTTAGTGGTGGG + Intronic
1133878017 16:9752880-9752902 TGAGTTCCCCACTTTGTGCAAGG - Intergenic
1138991020 16:62391619-62391641 TGAGGTCCACATCCAGTACGTGG - Intergenic
1147245381 17:39116874-39116896 TGTGTTCCACTCTTGGTGCGAGG - Intronic
1151163153 17:72182913-72182935 TGAGGCCAACACTGAGTGCTGGG + Intergenic
1156455030 18:37288243-37288265 TGAGGTCCTCCCTTCCTGCGCGG + Intronic
1167893919 19:52565460-52565482 TGAGGCCCACAGTTTGTGAGTGG - Intronic
1168002582 19:53461080-53461102 TGAGGTCCCCAGTTTGTGAGGGG - Intergenic
925413856 2:3656067-3656089 TCAGGTCCCCACCTAGTGAGCGG + Intergenic
1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG + Intergenic
949916215 3:8966647-8966669 TGGGGTCCACAGTAAGTGTGAGG - Intergenic
950325303 3:12103138-12103160 TAAGGTCCACAGTTAGTACCTGG + Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
960402140 3:117214082-117214104 TGGGGCCCACACTTGGTGCAAGG - Intergenic
969471419 4:7391551-7391573 TGAAGTCCACACTCAGTTCCTGG - Intronic
969603376 4:8189829-8189851 TAAGGGCCACACTCTGTGCGGGG - Intronic
970576884 4:17436828-17436850 CGGGGTCCACTCTGAGTGCGGGG + Intergenic
971624880 4:28906616-28906638 TGAAGTACAGACTTAGTGTGGGG + Intergenic
983886130 4:172982546-172982568 TGAAGTCTACAATTAGTGTGGGG + Intronic
1003115171 6:3278859-3278881 TGCCGTCCACATTTAGTGCCGGG - Intronic
1003799685 6:9649694-9649716 TGAAGTCCACACTTTGTTCCTGG + Intronic
1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG + Intergenic
1006605068 6:35250234-35250256 TGAGGTCCACACTGACTCCATGG - Exonic
1018071322 6:160167046-160167068 TGAGGTCCACACTGGCTGCTGGG + Intergenic
1022869791 7:34464206-34464228 TGCAGCCCACACTTAGTGGGTGG + Intergenic
1026796002 7:73366517-73366539 TGAGGTCCACACTGTGTGTGTGG - Intergenic
1046795671 8:118369096-118369118 TGTGCTCCACACTTTGTGTGAGG - Intronic
1061247837 9:129410191-129410213 CGAGGTCCACAGTAAGGGCGTGG - Intergenic
1191953422 X:66618639-66618661 TGAGGTACACACTCTGTGCCAGG - Intronic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1198016663 X:132618502-132618524 TGATCTCCACACTTCGTGGGTGG - Intergenic
1199866365 X:151853425-151853447 TGGGGTCCACAGTTAGTGGATGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic