ID: 1200587933

View in Genome Browser
Species Human (GRCh38)
Location Y:5032517-5032539
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200587933_1200587937 -9 Left 1200587933 Y:5032517-5032539 CCTGCCATGGAACCTCCTATCTA 0: 2
1: 0
2: 1
3: 8
4: 114
Right 1200587937 Y:5032531-5032553 TCCTATCTAGTGCAGCATTTGGG 0: 2
1: 0
2: 0
3: 10
4: 83
1200587933_1200587936 -10 Left 1200587933 Y:5032517-5032539 CCTGCCATGGAACCTCCTATCTA 0: 2
1: 0
2: 1
3: 8
4: 114
Right 1200587936 Y:5032530-5032552 CTCCTATCTAGTGCAGCATTTGG 0: 2
1: 0
2: 0
3: 8
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200587933 Original CRISPR TAGATAGGAGGTTCCATGGC AGG (reversed) Intronic
900623031 1:3596114-3596136 CAGAGAGGAGGCACCATGGCGGG + Intronic
901833312 1:11907158-11907180 CAGAGAGGAGGTTTCCTGGCCGG - Intergenic
904725826 1:32547179-32547201 TAGATATGAGCTACCATGCCCGG + Intronic
916558232 1:165911100-165911122 CACATAGGAGATTCCAGGGCAGG - Intronic
921759973 1:218901967-218901989 TGGATGGGAGACTCCATGGCTGG - Intergenic
922360784 1:224819476-224819498 GAGACAGGTGGTTCCATGGCAGG + Intergenic
922719337 1:227892361-227892383 GAGATGGGAGGTTCCAGGTCTGG + Intergenic
924506426 1:244689804-244689826 TAGAAAGGAGTTTCCTGGGCTGG - Intronic
1068498168 10:57811708-57811730 TAGATGGGAGGTTCCCTGGTGGG + Intergenic
1071049869 10:81434107-81434129 TATCTAGGAGGTTCCATGAAGGG - Intergenic
1071878677 10:89870655-89870677 TACAAAGGAGGGTCTATGGCTGG - Intergenic
1072559274 10:96555407-96555429 TAGATAAGAGGTTTCATGGAGGG - Intronic
1074392393 10:113069091-113069113 TAGAAAGGAGGGCCCAGGGCTGG + Intronic
1077817080 11:5696421-5696443 TAGGTCGGAGGTTCCCAGGCTGG - Exonic
1078040338 11:7855787-7855809 GAGATATGAGGATCCAAGGCTGG + Intergenic
1079030558 11:16983215-16983237 TTGATAGGAAGTTCCATTTCAGG - Intronic
1079325827 11:19491267-19491289 TAGAGAGGAGACTCAATGGCTGG - Intronic
1080720513 11:34843715-34843737 TAGAGAGGAGGCTGCATTGCTGG - Intergenic
1083167437 11:60899425-60899447 TGGATAGGTGGTTCCAGGGAGGG - Intronic
1089448344 11:118572245-118572267 GAGATACGAGGTTCCACAGCTGG + Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097699223 12:62802891-62802913 TAGATGGGAGGTTCCAGGCACGG - Intronic
1099876111 12:88407553-88407575 TAGATGGCAAGTTCCATGCCTGG + Intergenic
1103478963 12:121238655-121238677 TAGATGGAAGGTTCCGTGGTGGG + Exonic
1108929865 13:55805498-55805520 TAGAACGGAGGTTCCATGCTAGG + Intergenic
1111133993 13:84015248-84015270 TAGCCAGGTGGTTCAATGGCTGG + Intergenic
1112183254 13:97105419-97105441 TAGATGGAAAGTTCCATGGTGGG + Intergenic
1117272404 14:54158390-54158412 AAAATAGTGGGTTCCATGGCAGG - Intergenic
1117368019 14:55050802-55050824 TAGTTAGTAGGTTCCTTGACTGG + Intergenic
1119882503 14:78112030-78112052 TAGACAGGAGGTTCGATGAGTGG + Intergenic
1122263654 14:100536978-100537000 TAGATAGGAACTTGGATGGCGGG + Intergenic
1123840576 15:24243383-24243405 TAGCAAGGAAGTGCCATGGCCGG - Intergenic
1123869494 15:24556503-24556525 TAGCAAGGAAGTGCCATGGCCGG - Intergenic
1126855322 15:52833151-52833173 TAGCTAAGAGGTTCCCAGGCTGG - Intergenic
1128283497 15:66416866-66416888 AGGAAAGGAGGTACCATGGCAGG - Intronic
1130175986 15:81571427-81571449 GAGACAGTAGGTTCCATGGGAGG + Intergenic
1130909657 15:88262332-88262354 TAGACAGCAGGATCCAGGGCAGG + Intergenic
1131752793 15:95527485-95527507 GTGCTAGGAGGTTCCATGTCTGG + Intergenic
1134064410 16:11218361-11218383 TAGATCAGAAGTTCCATGCCTGG + Intergenic
1135119867 16:19756588-19756610 TATAAAAGAGGCTCCATGGCCGG + Intronic
1135502899 16:23012635-23012657 AAGATTGGAGGTACCATTGCTGG + Intergenic
1136000692 16:27290505-27290527 AAGGTAGGAGTTTCCAGGGCTGG + Intergenic
1138544363 16:57706876-57706898 TGGATAGGAGGATGCATGGGAGG - Intronic
1140479959 16:75257091-75257113 CAGAGAGGAAGCTCCATGGCTGG + Intronic
1141509197 16:84501653-84501675 GAGAGAGGAGGTTGCATGGGAGG + Intronic
1141599706 16:85118193-85118215 TAGATGGTAGGTGCAATGGCTGG - Intergenic
1147038774 17:37701288-37701310 TACATAGGAGATTCCATGGGAGG + Intronic
1151260618 17:72913141-72913163 TAGATAGGAGGTAAGAGGGCAGG + Intronic
1152358366 17:79817579-79817601 TAGTTAGGAGGCTAGATGGCTGG - Intergenic
1153981815 18:10316801-10316823 TAGATAAGAGATAACATGGCTGG - Intergenic
1154412611 18:14149425-14149447 TAGGGAGGAGGGGCCATGGCTGG + Intergenic
1159708228 18:71719045-71719067 AAGTTTGGAGGTTCCCTGGCTGG - Intergenic
1163160049 19:15458789-15458811 AAGCAAGGAGGTGCCATGGCGGG - Intronic
1164715543 19:30387971-30387993 TAGATAGGATGGTCCATAGGTGG + Intronic
1167672066 19:50859162-50859184 CAGAGAGGAGGTTGCCTGGCTGG + Intronic
1167869640 19:52357237-52357259 CAGATATGAGGTACCATGCCGGG - Intronic
1168190733 19:54736805-54736827 CACATAGGAGGTTCCAAGGATGG + Intronic
925241684 2:2336715-2336737 TAGGAAGGAGGTTCCAATGCTGG - Intergenic
930943394 2:57041123-57041145 TAGAGAAGAGTTTCCAGGGCTGG + Intergenic
932573697 2:72951327-72951349 TGGATAGGATGCTCCATGTCTGG - Intronic
937146696 2:119652530-119652552 TGGTTAGGTGCTTCCATGGCTGG - Intronic
937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG + Intergenic
942493719 2:176516829-176516851 TAGATATGAGGATCCATTTCTGG + Intergenic
943004207 2:182369876-182369898 TAGAAAGGAGTTTCATTGGCTGG + Intronic
945895773 2:215480043-215480065 TGGACAAGAGGTTCCCTGGCAGG - Intergenic
1172193934 20:33079282-33079304 TAGACAGGAGGTGCCCAGGCTGG - Intergenic
1172856106 20:38003806-38003828 AAGCTGGGAAGTTCCATGGCTGG + Intronic
1173138010 20:40457453-40457475 TAGACAGGAGATTCCCTGGCAGG + Intergenic
1174179769 20:48667539-48667561 GAGCTAGGTGGTTCCAGGGCTGG - Intronic
1174349172 20:49954874-49954896 TAAATTTGAGGTTCCAGGGCCGG - Intergenic
1175506830 20:59492057-59492079 TAGCCAGGAGCTCCCATGGCTGG - Intergenic
1175576660 20:60065593-60065615 CAGATAGAAAGTTCCATGCCGGG + Intronic
1176725903 21:10432289-10432311 TAGATAGGAGCCACCATGGCAGG + Intergenic
1176860395 21:14008830-14008852 TAGGGAGGAGGGGCCATGGCTGG - Intergenic
1177665088 21:24146251-24146273 AAGATAGTAAGTTCCATTGCTGG - Intergenic
1182342362 22:29633671-29633693 CAGACAGGAGGTGGCATGGCGGG - Intronic
1182438121 22:30344175-30344197 TAGCTAGGAGGTGGCAGGGCTGG - Intronic
1182775949 22:32831056-32831078 AAAATAGCAGCTTCCATGGCTGG + Intronic
1185423186 22:50746697-50746719 CAGAGAGAAGGTGCCATGGCAGG + Intergenic
952323165 3:32296745-32296767 CAGATCTGAGGTTCCATGGGTGG + Intronic
956177093 3:66483399-66483421 TTGATAGAAGCTTCTATGGCAGG - Intronic
960405434 3:117253668-117253690 CAGAAAGGAGGAGCCATGGCTGG + Intergenic
961517451 3:127446817-127446839 CAGATGGGAGGTACAATGGCAGG - Intergenic
964202219 3:154130715-154130737 TAGAAAGGAATTCCCATGGCTGG + Intronic
966408601 3:179625717-179625739 TAGAAAGGTGGTTACAAGGCTGG - Intronic
976831552 4:89320597-89320619 TGGACAGGAGGTAACATGGCTGG - Intergenic
978701051 4:111646692-111646714 TAGATAGAAAGCTCCATGTCAGG - Intergenic
981398300 4:144280649-144280671 TGGGTAGGAGGTTCCATGTTAGG + Intergenic
982530218 4:156531948-156531970 TATATAGGATGTTTCATGTCTGG + Intergenic
984108666 4:175581534-175581556 TAGATCAGAGGTTCTATGCCAGG - Intergenic
993971494 5:94425459-94425481 TAGACATGAGCTTCCATGCCTGG - Intronic
995757652 5:115526694-115526716 TAGAAAAGAGGTAGCATGGCAGG + Intronic
998729821 5:145062023-145062045 TAGGGTGGAGGTTCCATGACAGG + Intergenic
999203341 5:149831836-149831858 TAAAGGGGAGGCTCCATGGCTGG - Intronic
999695385 5:154184397-154184419 TTGCTAAGAGGTTCCATAGCTGG + Intronic
999933986 5:156465170-156465192 TAGGTAGGAGGTTTCCTGGAGGG - Intronic
1003054251 6:2804596-2804618 TCAAGAGGAGGTTCCATAGCAGG - Intergenic
1003583508 6:7364286-7364308 TAGAGAAGAGGTACAATGGCTGG - Intronic
1005881884 6:30068509-30068531 AAGAGAGGAGGTTCCCTGGGAGG + Intronic
1009189556 6:60613205-60613227 TGGAAAGAAGGTTTCATGGCTGG - Intergenic
1012402962 6:98859611-98859633 AACATAGGAGATTCCATAGCTGG + Intergenic
1019549432 7:1594735-1594757 TAGATAGGAGGATGGATGGATGG - Intergenic
1021861018 7:24906169-24906191 CAGGTAGGAGGTTCCATCACTGG + Intronic
1024676249 7:51640315-51640337 TAGAAAGGAAGCTCCCTGGCAGG + Intergenic
1026206490 7:68262187-68262209 TAGGTAGGAGGTTCCATGCCAGG + Intergenic
1033801730 7:144909511-144909533 TAGCCAGCAGGTTCCATGGAGGG - Intergenic
1038330022 8:26600919-26600941 CAGATAGGTGGTTCCATGCTGGG + Intronic
1038582009 8:28755912-28755934 TAGATGGGACGCTCCAAGGCGGG - Intergenic
1039585436 8:38703315-38703337 GAGATGTGAGGTTCCCTGGCTGG + Intergenic
1039782499 8:40799028-40799050 TAGATAGAAGGATAGATGGCTGG + Intronic
1041878389 8:62716818-62716840 TAGATGTGAGCTACCATGGCTGG - Intronic
1044565463 8:93657515-93657537 TATATAGTAGGTTCCCTAGCAGG - Intergenic
1045439421 8:102194722-102194744 GTGATAGGAGGTTTCAAGGCTGG + Intergenic
1046102246 8:109628637-109628659 TAGATATGAGGGTCTCTGGCTGG - Intronic
1051059434 9:13029080-13029102 TAGATAGTAGGTTGCATAGCAGG - Intergenic
1057736567 9:97667599-97667621 TAGCTAGTAGGTTGCATAGCTGG + Intronic
1062045495 9:134422687-134422709 TACATAGGAGGTCCCAGGACGGG - Intronic
1188065036 X:25648452-25648474 TAGAAAGGAGTTTCCAGGGGTGG + Intergenic
1188997105 X:36899150-36899172 TAGAGTGGAGGTTCCATGTCTGG - Intergenic
1192218360 X:69179592-69179614 TTGAGAGCAGGGTCCATGGCAGG + Intergenic
1194270701 X:91811084-91811106 TAGATAGGAGGTTCCATGGCAGG - Intronic
1198650402 X:138857375-138857397 TAGCTAGGAGGCCCCCTGGCTGG - Intronic
1199665501 X:150093468-150093490 TAGGCAGGAGGTTCCAAGGAAGG - Intergenic
1200587933 Y:5032517-5032539 TAGATAGGAGGTTCCATGGCAGG - Intronic
1201377381 Y:13338211-13338233 TAGAAACGGGGTTTCATGGCTGG + Intronic