ID: 1200594863

View in Genome Browser
Species Human (GRCh38)
Location Y:5125975-5125997
Sequence CTGACGAATGAGATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200594855_1200594863 17 Left 1200594855 Y:5125935-5125957 CCAGGACTAGGGTAGTAGAGGTG 0: 2
1: 1
2: 2
3: 19
4: 141
Right 1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG 0: 1
1: 1
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200594863 Original CRISPR CTGACGAATGAGATGGTGGA GGG Intronic
900763010 1:4485607-4485629 CTGACGGCTGAGAGGGAGGAAGG + Intergenic
901118832 1:6873486-6873508 CTGAGGGATGAGCTGGTTGATGG + Intronic
902203461 1:14851076-14851098 CTGACACATCTGATGGTGGAAGG - Intronic
903764568 1:25725851-25725873 CTGAAGAATGAGAGGGTGCTCGG + Intronic
907327599 1:53650740-53650762 CAGACTAAAGAGATGGCGGAAGG + Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
908342512 1:63196401-63196423 TTCACGAAGGAGATGGTGGTTGG - Intergenic
908709235 1:66996297-66996319 CTTAAGCATGAGATGGTGGCTGG - Intergenic
915381194 1:155442246-155442268 CTAAAGAATGAGTTGGAGGATGG - Intronic
921155951 1:212438962-212438984 ATGACAACTGAGAAGGTGGAGGG - Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1068268577 10:54688247-54688269 CTAACTAATGGGATGGTTGAGGG - Intronic
1072613046 10:97031681-97031703 CGGAGGAAGGAGATGGAGGAAGG + Intronic
1072679323 10:97495037-97495059 CTGACGTATGAGATGCTGTCTGG + Intronic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1076051397 10:127336459-127336481 CTGACGACTGAGAAAGTGCAGGG - Intronic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1078256006 11:9659402-9659424 CTGACGAATGAGTACATGGAAGG + Intergenic
1079618987 11:22529955-22529977 CTGATGAATAAAATGGTCGAAGG - Intergenic
1083961532 11:66017405-66017427 CTGACAAATGGGTGGGTGGAGGG - Intronic
1084937345 11:72594178-72594200 CTGATGGATGAGGGGGTGGATGG + Intronic
1085837192 11:79969698-79969720 CAAATGAATGAGAGGGTGGAAGG + Intergenic
1089325420 11:117653441-117653463 GTGATGAATGAGCTGGGGGAAGG - Intronic
1090899336 11:131013559-131013581 CAGAGGAATGACATGGTGGTGGG + Intergenic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1095815003 12:46411757-46411779 CTGACGAATGAAAAGGAGAAGGG + Intergenic
1099567891 12:84276348-84276370 CTGCCAAATGGGATGCTGGAGGG - Intergenic
1100916979 12:99435314-99435336 CTAAAGAATGAGATGCTTGAAGG + Intronic
1102676634 12:114664019-114664041 CTGACGTATGTGGAGGTGGAAGG + Intergenic
1107564426 13:41587394-41587416 CTGATGAATGAGCTGGTGAGAGG + Intronic
1107826327 13:44332010-44332032 CTGACAAAGGAGGTGGTGGAGGG - Intergenic
1108622109 13:52194661-52194683 CCGCCGAACGAGATAGTGGAGGG + Intergenic
1108963066 13:56261393-56261415 GTGATGAGTGAGAAGGTGGATGG - Intergenic
1109317514 13:60767752-60767774 CTGGGGATTGAGATGGTGGTGGG - Intergenic
1110810934 13:79809875-79809897 CTGAAGGATGAGATGAAGGAAGG - Intergenic
1115706761 14:36007307-36007329 AAGACAGATGAGATGGTGGAGGG + Intergenic
1116752253 14:48901128-48901150 TTCACCAATGAGATGGGGGATGG + Intergenic
1117518609 14:56527888-56527910 CTGGCCAATGAGATGCTGGATGG + Intronic
1120706191 14:87748297-87748319 CTGGCTAATGAGATGGTGTAAGG - Intergenic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1122320719 14:100854002-100854024 CTGATGGATAAGAGGGTGGAAGG + Intergenic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1124003157 15:25776320-25776342 CTGACGGATGGGGTGGGGGAGGG + Intronic
1124347548 15:28932579-28932601 CTGACAGTGGAGATGGTGGACGG + Intronic
1124592298 15:31063987-31064009 CTGAAGAATAAGATGATGAAAGG + Intronic
1128757062 15:70190281-70190303 CTGATGAGAGAGATGTTGGACGG + Intergenic
1129994886 15:79996095-79996117 CTGACGAGTGACATGGGGCAGGG - Intergenic
1134049687 16:11128703-11128725 CTGACTACTGAGATGGGGGTGGG - Intronic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1136071445 16:27790030-27790052 CTGATGAATGAGTGGATGGATGG + Exonic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1138649280 16:58449653-58449675 ATGAAGAATGAGATGGAAGAAGG + Intergenic
1139394029 16:66625543-66625565 GTGAAGAATGAGATGATGAATGG + Intronic
1142562132 17:816476-816498 CGGACCAAGCAGATGGTGGAGGG - Intronic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1144434613 17:15229367-15229389 CTGAGGTATGATATGGTGAAAGG - Intergenic
1151104200 17:71593440-71593462 GTGAAGAATGAGTTGGTTGAAGG - Intergenic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1155126055 18:22876824-22876846 ATAAGGAATGAGATGGTGAAAGG - Intronic
1155698489 18:28713636-28713658 CAGAGGAATGAGGTGGTGGGGGG - Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1159028873 18:63210877-63210899 CAGAACAATGAGATGGTGAATGG - Intronic
1165247373 19:34505181-34505203 CTGAGGCCTGAGGTGGTGGAAGG + Exonic
1165759159 19:38310435-38310457 TAGATGAATGAGTTGGTGGATGG - Intronic
1165903044 19:39177699-39177721 ATGGTGATTGAGATGGTGGACGG + Exonic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166455724 19:42938261-42938283 CTCACGCCTGAGATGGTGGGTGG + Intronic
1167348730 19:48962445-48962467 CTGGCGACTGAGAGGCTGGAGGG + Intergenic
1168561034 19:57383513-57383535 CAGAAGAATGGGATGGTGGGGGG - Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929908263 2:46065439-46065461 CGGACAAATGAGAAGATGGAAGG - Intronic
930593051 2:53353196-53353218 CTGAGGATTAAGATGGTGGATGG + Intergenic
936418596 2:112343183-112343205 CTGAGGAATGAGGTGGAGGATGG + Intergenic
939702938 2:145416804-145416826 ATGACTCATGAGTTGGTGGAGGG - Intergenic
942019663 2:171854127-171854149 ATGCTGAATGAGATGATGGAGGG + Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943329933 2:186547001-186547023 CTGAGGAATGAGTGGGTGGTAGG - Intergenic
945287376 2:208096088-208096110 CTGACAAATGAGAGGAAGGATGG - Intergenic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
947914430 2:233822373-233822395 CTTCTGAATGAGAAGGTGGATGG - Exonic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1172025894 20:31948254-31948276 CTGGCCAATGAGATGTTGGCAGG + Intronic
1173159173 20:40639606-40639628 CAGATGAATGAGATGGTAGATGG - Intergenic
1173918534 20:46726969-46726991 CTCACCAATGAGATCGAGGAAGG - Exonic
1174041898 20:47706141-47706163 CTGAGGGGTGAGATGCTGGAGGG - Intronic
1175530694 20:59672741-59672763 ATGAGGAGAGAGATGGTGGAGGG - Intronic
1175584571 20:60127760-60127782 CTCAGGAATGAGATGTTGGGTGG - Intergenic
1175817228 20:61889574-61889596 ATGATGAATGAGTTAGTGGATGG + Intronic
1176524994 21:7859386-7859408 CTTACAAATGAGATGGAGCAGGG - Intergenic
1178537779 21:33424578-33424600 CAGAGGAGTGAGATGGTGGTTGG + Intronic
1178659014 21:34489399-34489421 CTTACAAATGAGATGGAGCAGGG - Intergenic
1179923200 21:44518673-44518695 CTAACGAATGAGCTGGTGGGGGG - Exonic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
950009616 3:9713520-9713542 CGGATGAATGAGCTGATGGATGG + Intronic
951746772 3:25987022-25987044 CTGACCACTGAGCTGATGGACGG - Intergenic
952901076 3:38112089-38112111 CTGACCAAGGAGAGGCTGGAGGG + Intronic
953759050 3:45672633-45672655 GGGAAGGATGAGATGGTGGAAGG - Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
959752475 3:109855005-109855027 CTGAATCATGACATGGTGGAAGG + Intergenic
960430147 3:117559281-117559303 TTTATGAATAAGATGGTGGAAGG + Intergenic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
964689803 3:159437587-159437609 CGGAGGAAGGAGACGGTGGAGGG + Intronic
966955573 3:184874756-184874778 CCCACAACTGAGATGGTGGAAGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967852313 3:194091400-194091422 GTGACTCATGGGATGGTGGAAGG - Intergenic
969430724 4:7152458-7152480 CTAAAGAATGAGGTGGTGGCCGG - Intergenic
969599318 4:8166663-8166685 CTGACGGATGAATGGGTGGATGG - Intergenic
969847417 4:9930235-9930257 CTGATGAAAGTGATGGTGAAGGG - Intronic
970250057 4:14104941-14104963 CTGATAAATGAGATGGTCAAGGG + Intergenic
970986403 4:22163896-22163918 CTGATGAATGATATGGTGGGGGG - Intergenic
971176282 4:24285398-24285420 ATGAGGAATGAGAGGGTGAAAGG + Intergenic
974091874 4:57320017-57320039 TGGAAGAATGAGATGGTGGCAGG + Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976143598 4:82019258-82019280 ATGATGAAAGAGATGGTGGAAGG + Intronic
981747916 4:148068837-148068859 CTGAAAACTGAGTTGGTGGAAGG + Intronic
982933398 4:161437766-161437788 GTGAGAAGTGAGATGGTGGATGG + Intronic
983217870 4:165018798-165018820 CTGACCAATGAGTTGGTAGAGGG + Intergenic
986921560 5:12689783-12689805 CTAACAAATGAGAATGTGGATGG + Intergenic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
996222972 5:120954914-120954936 CTGACGAAAGAAATGGAAGATGG - Intergenic
997228218 5:132225476-132225498 CTGAGGAATGAGTCGGTTGAGGG - Intronic
998749653 5:145305625-145305647 CTGACCAATGAAAAGCTGGATGG - Intergenic
1001715949 5:173816159-173816181 GTGAGGAGTGAGATGGTGGGTGG - Intergenic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1007256775 6:40535223-40535245 CTGTCAAATGAGATGATGAAAGG + Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010569831 6:77463449-77463471 CGGACGAAGGAGAGGGCGGAAGG + Exonic
1011664327 6:89620286-89620308 CTGACTAATGATATGGTGAATGG + Intronic
1012468679 6:99545398-99545420 CTGAAAAATGAGATGCTAGAAGG - Intronic
1013036771 6:106392538-106392560 CACAGGAAAGAGATGGTGGAGGG + Intergenic
1015345385 6:132150827-132150849 TTGAGGAATGAGATATTGGATGG + Intergenic
1017347808 6:153405155-153405177 CAGACGAATCAGGTTGTGGATGG - Intergenic
1017835285 6:158171750-158171772 CTGACGAAGGACATGGTGAGGGG + Intronic
1020361223 7:7328821-7328843 CTGAAGTAGGAGTTGGTGGAAGG - Intergenic
1022313291 7:29218195-29218217 CTGGCGAGTGAGGGGGTGGAAGG - Intronic
1033277800 7:139985805-139985827 CTGAGGAATGAATGGGTGGACGG + Intronic
1034483446 7:151341390-151341412 CTGAGGAATGAGATGCGGGTTGG + Intergenic
1035290828 7:157837432-157837454 CTGATGGAAGAGGTGGTGGAGGG + Intronic
1038839315 8:31166303-31166325 CAGAAGAATGTGATGTTGGAAGG + Intronic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1042927284 8:73978802-73978824 CTGACAAATCAGAAGATGGAAGG + Exonic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1044398151 8:91738313-91738335 CTGACCTCTGAGATGGTGGTAGG + Intergenic
1044463109 8:92470528-92470550 TTGACTTATGAGATGGAGGAGGG - Intergenic
1048207159 8:132424411-132424433 CTGTCGAATGAGAGGGTTGGGGG - Intronic
1049008350 8:139871925-139871947 CAGATGAATGAGTTGATGGATGG + Intronic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1054803419 9:69375636-69375658 CTGTAGAATGAGATGATGGCAGG - Intronic
1056471658 9:86910328-86910350 CTGAAGAATGAGATGTTTGTAGG + Intergenic
1057821145 9:98332035-98332057 CTGTCAAATGAGCTGATGGATGG - Intronic
1189925891 X:45954319-45954341 CTGAGGAATGAGATGCTTGTAGG - Intergenic
1190793173 X:53718832-53718854 CAGACGGATGAGATGGTATATGG - Intergenic
1190932579 X:54961959-54961981 CTGAGGCCTGAGATGCTGGAAGG + Intronic
1194277519 X:91903886-91903908 CTAACGAATGAGATGGTGGAGGG + Intronic
1196862289 X:120039673-120039695 CTGAGGAAAGAGATGGTCGTTGG + Intergenic
1196880813 X:120196671-120196693 CTGAGGAAAGAGATGGTCGTTGG - Intergenic
1196894315 X:120319954-120319976 CTGAAGAATGACATTGGGGAAGG - Intergenic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic