ID: 1200597554

View in Genome Browser
Species Human (GRCh38)
Location Y:5163695-5163717
Sequence CTGGAGGCTTACAATCATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8888
Summary {0: 2, 1: 31, 2: 372, 3: 3631, 4: 4852}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200597554 Original CRISPR CTGGAGGCTTACAATCATGG CGG (reversed) Intronic
Too many off-targets to display for this crispr