ID: 1200601248

View in Genome Browser
Species Human (GRCh38)
Location Y:5208202-5208224
Sequence ACTGTTCTCCGGACAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 377}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200601248 Original CRISPR ACTGTTCTCCGGACAGTGAA TGG (reversed) Intronic
901464383 1:9411956-9411978 ACTGTTCTCGTGACGGTGAATGG + Intergenic
903101106 1:21030341-21030363 GCTGTTCTCTTGATAGTGAATGG + Intronic
903443867 1:23408315-23408337 ACTGGTCCCCTGACAGTGATGGG + Intronic
905492549 1:38355756-38355778 GCTGTTCTCAGGATAGTGAATGG + Intergenic
905496019 1:38387162-38387184 GCTGTTCTCATGATAGTGAATGG - Intergenic
906187916 1:43875574-43875596 GCTGTTCTCATGATAGTGAATGG + Intronic
906763852 1:48408816-48408838 GCTGTTCTCATGATAGTGAATGG - Intronic
907186414 1:52612746-52612768 ACTGTGCTCAGGAGAGGGAAGGG - Intergenic
908068746 1:60435318-60435340 GCTGTTCTCATGATAGTGAATGG - Intergenic
908387787 1:63659000-63659022 GCTGTTCTCATGATAGTGAATGG - Intronic
908640167 1:66213906-66213928 ACTCTTCTCCTGAAAGTGATGGG - Intronic
908667819 1:66511490-66511512 GCTTTTCTCCTGATAGTGAATGG + Intergenic
909153912 1:72045488-72045510 GCTGTTCTCCTGATAGTGAATGG + Intronic
909185509 1:72481162-72481184 ACTGTTCTTGTGATAGTGAATGG - Intergenic
909204521 1:72738426-72738448 GCTGTTCTCTTGAGAGTGAATGG - Intergenic
909602792 1:77478380-77478402 GCTGTTCTCATGATAGTGAATGG + Intronic
910309227 1:85804674-85804696 GCTGTTCTCGTGATAGTGAATGG - Intronic
910512758 1:88025003-88025025 GCTGTTCTCATGATAGTGAATGG - Intergenic
911134822 1:94428603-94428625 GCTGTTCTCGTGATAGTGAACGG + Intronic
911686399 1:100781806-100781828 GCTGTTCTCGTGATAGTGAATGG - Intergenic
911840625 1:102676705-102676727 CCTTTTCTCATGACAGTGAATGG - Intergenic
912609335 1:111027643-111027665 GCTGTTCTCCTGATAGTGAATGG + Intergenic
912654972 1:111477789-111477811 ACTGTTTTGGGGACACTGAAGGG + Intronic
915767240 1:158374711-158374733 ACTGTTAACCTGACAGTGAGAGG - Intergenic
916959076 1:169871303-169871325 CCTGTTCTCATGATAGTGAATGG + Intronic
917023589 1:170616108-170616130 GCTGTTCTCACGATAGTGAATGG + Intergenic
917642876 1:176999759-176999781 ATTGTTCTCGGGATAGTGAGTGG + Intronic
918727898 1:187948505-187948527 GCTGTTCTCATGATAGTGAATGG + Intergenic
922115201 1:222606890-222606912 GCTGTTCTCATGATAGTGAATGG - Intergenic
923259379 1:232252753-232252775 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1065739992 10:28788583-28788605 ACTGTTTTACTGACAGTCAAAGG + Intergenic
1067354947 10:45515656-45515678 ACACATGTCCGGACAGTGAAAGG - Intronic
1067834036 10:49627117-49627139 ACTGTTCTCCAGAAGGGGAATGG - Intronic
1068055808 10:52011843-52011865 GCTGTTCTCGTGATAGTGAATGG + Intronic
1068264402 10:54627405-54627427 ACTGTTCTCATGATAGTGAATGG + Intronic
1068305768 10:55205979-55206001 GCTGTTCTCGTGATAGTGAATGG - Intronic
1070375840 10:75830601-75830623 ATTGTTCTCATGATAGTGAATGG - Intronic
1072307134 10:94118530-94118552 GCTGTTCTCATGATAGTGAATGG + Intronic
1073730601 10:106283054-106283076 GCTGTTCTCATGATAGTGAATGG - Intergenic
1075826020 10:125357624-125357646 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1077797265 11:5505703-5505725 GCTGTTCTCGTGACAGTGAATGG - Intronic
1079298326 11:19254714-19254736 GCTGTTCTCATGATAGTGAATGG - Intergenic
1080088380 11:28314806-28314828 GCTGTTCTCCTGATAGTGAATGG + Intronic
1081019639 11:37929582-37929604 ACAATTCTCTTGACAGTGAAAGG + Intergenic
1081120741 11:39262687-39262709 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1081507768 11:43735929-43735951 GCTGTTCTCGTGACAGTGAGTGG - Intronic
1083120252 11:60505279-60505301 GCTGTTCTTGTGACAGTGAATGG - Intronic
1083814598 11:65125580-65125602 ACTGTGATCCGGAAAGTGGAAGG + Exonic
1085668742 11:78440952-78440974 ACTGTTCTTAGGTCAGGGAAGGG - Intronic
1085941959 11:81215210-81215232 GCTATTCTCCTGATAGTGAATGG - Intergenic
1086850218 11:91799648-91799670 ACTATTCTCGTGATAGTGAATGG - Intergenic
1087226490 11:95606599-95606621 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1087244884 11:95823604-95823626 ACATTTCTCTGGACTGTGAATGG - Intronic
1087516699 11:99173084-99173106 GCTGTTCTCATGACAGTGAGTGG - Intronic
1087838223 11:102895998-102896020 GCTGTTCTCATGATAGTGAATGG + Intergenic
1088206152 11:107395165-107395187 GCTGTTCTCGTGATAGTGAATGG + Intronic
1088531228 11:110811926-110811948 ACTGTTCTCATGATAGTGAATGG - Intergenic
1088668350 11:112117375-112117397 GCTGTTCTCATGATAGTGAATGG - Intronic
1089584296 11:119500431-119500453 GCTGTTCTCATGATAGTGAACGG + Intergenic
1089859115 11:121573003-121573025 GCTGCTCTCAGGAGAGTGAAAGG - Intronic
1090638796 11:128712671-128712693 GCTGTTCTCATGATAGTGAATGG - Intronic
1093193702 12:16105334-16105356 GCTGTTCTCATGATAGTGAATGG - Intergenic
1093352972 12:18127135-18127157 GCTGTTCTAGTGACAGTGAATGG + Intronic
1094069039 12:26392566-26392588 ACTGTTCTCCAGACACTGCCAGG - Intronic
1094759419 12:33513397-33513419 GCTGTTCTCCTGATAGTAAATGG + Intergenic
1097429450 12:59486537-59486559 GCTGTTCTCCTGACAGTGGTTGG + Intergenic
1098201220 12:68058032-68058054 GCTGTTCTCATGATAGTGAATGG - Intergenic
1098743296 12:74201656-74201678 GCTGTTCTTATGACAGTGAATGG - Intergenic
1098792224 12:74837816-74837838 GCTGTTCTTGGGATAGTGAATGG + Intergenic
1100072353 12:90736124-90736146 GCTGTTCTCATGACAGTGAGTGG - Intergenic
1100576959 12:95901009-95901031 TCTGTTCTCCATACAGTGATAGG - Intronic
1101464729 12:104936625-104936647 GCTGTTCTCATGATAGTGAATGG - Intronic
1101766007 12:107700065-107700087 GCTGTTCTCATGATAGTGAATGG - Intronic
1106877424 13:34088996-34089018 GCTGTTCTCATGACAGTGAGTGG + Intergenic
1107554622 13:41507174-41507196 GCTGTTCTCATGAGAGTGAATGG - Intergenic
1107863159 13:44680302-44680324 GCTGTTCTCATGATAGTGAATGG + Intergenic
1109285598 13:60404907-60404929 GCTGTTCTCGTGATAGTGAATGG + Intronic
1109401348 13:61833291-61833313 ACTGTGCTCAGGACAATAAAAGG - Intergenic
1109803501 13:67406070-67406092 AATGTTCTCAGGAGAGAGAAAGG + Intergenic
1109906068 13:68844261-68844283 GCTGTTCTCATGATAGTGAATGG + Intergenic
1110377725 13:74813440-74813462 ACTGTTCTCATGATAGTGAATGG + Intergenic
1110377981 13:74815275-74815297 GCTGTTCTCATGATAGTGAATGG + Intergenic
1110649273 13:77924791-77924813 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1111029246 13:82574517-82574539 GCTGTTCTCATGATAGTGAATGG - Intergenic
1112071268 13:95853032-95853054 CCTGTTCTCTTGACAGTGAGTGG + Intronic
1112320037 13:98397414-98397436 ACTGTTCACCAGAGTGTGAATGG - Intronic
1114320831 14:21546000-21546022 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1114589104 14:23843310-23843332 GCTGTTTTCCTGGCAGTGAAGGG + Intergenic
1114764886 14:25359599-25359621 ACTGTTCTCCTCACAATGATTGG - Intergenic
1114984407 14:28209283-28209305 GCTGTTCTCATGATAGTGAATGG + Intergenic
1115002437 14:28439207-28439229 GCTGTTCTCGTGACAGTGAATGG + Intergenic
1115404297 14:32997530-32997552 GCTGTTCTTGGGATAGTGAATGG + Intronic
1115773391 14:36689242-36689264 GCTGTTCTCGTGATAGTGAATGG - Intronic
1115968348 14:38916929-38916951 ACTGTTCTCATGATAGTGATGGG - Intergenic
1116642603 14:47484737-47484759 GCTGTTCTCCTAATAGTGAATGG + Intronic
1116761964 14:49026009-49026031 GCTGTTCTCATGATAGTGAATGG + Intergenic
1116762229 14:49027939-49027961 GCTGTTCTCATGATAGTGAATGG + Intergenic
1116788525 14:49314376-49314398 AGTGTTCTCAGGAGCGTGAAGGG + Intergenic
1117313156 14:54548453-54548475 ACTTTTCTCCTGACAGTAAATGG - Intergenic
1117977604 14:61313791-61313813 GCTGTTCTCATGACAGTGAGTGG - Intronic
1118069482 14:62230774-62230796 GCTGTTCTCATGATAGTGAATGG + Intergenic
1118863816 14:69686723-69686745 GCTGTTCTCATGATAGTGAATGG - Intronic
1120248055 14:82028830-82028852 GCTGTTCTCATGATAGTGAATGG - Intergenic
1120712620 14:87808360-87808382 GCTGTTCTCATGAAAGTGAATGG + Intergenic
1121508990 14:94498342-94498364 GCTGTTCTCCTCACGGTGAAAGG - Exonic
1121536304 14:94693353-94693375 GCTGTTCTCCTGATAGTGAATGG + Intergenic
1121874312 14:97437385-97437407 GCTGTTCTTGCGACAGTGAATGG + Intergenic
1121937344 14:98032060-98032082 GCTGTTCTCATGATAGTGAATGG + Intergenic
1125125411 15:36214471-36214493 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1127129072 15:55843024-55843046 ACTGTTCTCATGATAGTGAATGG + Intronic
1127666448 15:61152353-61152375 ACTCTTTTCCTCACAGTGAATGG - Intronic
1128535712 15:68488770-68488792 GCTGTTCTTGTGACAGTGAATGG - Intergenic
1128718491 15:69928053-69928075 GCTGTTCTCATGATAGTGAATGG - Intergenic
1128804899 15:70523393-70523415 GCTGTTCTCCTGATAGTGAGTGG - Intergenic
1130084080 15:80762727-80762749 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1131005085 15:88971440-88971462 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1131642085 15:94303601-94303623 GCTGTTCTCGTGACAGTGAATGG - Intronic
1131726447 15:95230846-95230868 AGTGTTCTCTGGTCAGTAAAGGG - Intergenic
1131914693 15:97251974-97251996 GCTGTTATCCTGATAGTGAACGG + Intergenic
1133851214 16:9505652-9505674 GCTGTTCTTGGGAGAGTGAATGG - Intergenic
1134562914 16:15226240-15226262 ACTGTTCTTAGGACTGAGAAAGG + Intergenic
1134923451 16:18137873-18137895 ACTGTTCTTAGGACTGAGAAAGG + Intergenic
1137775198 16:51048408-51048430 ACAGTTCTCCAGACAGAGAGAGG - Intergenic
1140424534 16:74849700-74849722 GCTGTTCTCGTGACAGTGAGTGG + Intergenic
1140566299 16:76046832-76046854 ACTGTTCTCATGACAGTGAATGG - Intergenic
1142286629 16:89174078-89174100 ACTGTTCTTCCCACAGTGGAAGG + Intronic
1143244306 17:5469541-5469563 ACTGTTATTTGGACAGAGAAGGG - Intergenic
1149214313 17:54336194-54336216 ACTGTTCTTGTGATAGTGAATGG + Intergenic
1149851832 17:60041716-60041738 ACTGCTCTCTGGGCAGTGATTGG - Intergenic
1151500857 17:74487875-74487897 GCTGTTCTTCTGATAGTGAATGG - Intergenic
1154049632 18:10941936-10941958 GCTGTTCTCATGATAGTGAAGGG + Intronic
1154049894 18:10943860-10943882 GCTGTTCTCATGATAGTGAATGG + Intronic
1154147137 18:11875513-11875535 ACTGTTTTCAAGATAGTGAATGG + Intronic
1154253529 18:12764234-12764256 GCTGTTCTCAGGATAGTGACTGG + Intergenic
1155807383 18:30189109-30189131 GCTGTTCTCATGATAGTGAATGG - Intergenic
1155851586 18:30781552-30781574 ACTGTTCTCATGATAGTGAATGG + Intergenic
1156254437 18:35381718-35381740 GCTGTTCTCATGATAGTGAATGG - Intergenic
1158483905 18:57847566-57847588 GCTGTTCTCATGATAGTGAATGG - Intergenic
1158918631 18:62164557-62164579 GCTGTTCTCCTGATAGTGAGTGG - Intronic
1159650263 18:70970334-70970356 GCTGTTCTCATGATAGTGAATGG - Intergenic
1159718995 18:71861670-71861692 GCTGTTCTCATGATAGTGAATGG - Intergenic
1159762927 18:72451246-72451268 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1160126997 18:76184507-76184529 AATGTTCTCATGATAGTGAATGG + Intergenic
1160331240 18:77993774-77993796 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1163472034 19:17503113-17503135 GCTGTTCTCATGATAGTGAAGGG - Intronic
1164274789 19:23706766-23706788 GCTGTTCTCATGACAGTGAATGG + Intergenic
1165193755 19:34085334-34085356 ACTGTTCTCCCCACAGTGAGTGG + Intergenic
1166623857 19:44331698-44331720 ACTGTTCACTTGGCAGTGAAAGG - Intronic
1168582462 19:57566917-57566939 GCTGTTCTCCCGACTGTTAAAGG + Intergenic
926377778 2:12250892-12250914 GCTGTTCTCGTGACAGTGAATGG + Intergenic
926607873 2:14915523-14915545 GCTATTCTCATGACAGTGAATGG + Intergenic
926713904 2:15908634-15908656 GCTGTTCTCGTGATAGTGAACGG + Intergenic
927298108 2:21478141-21478163 GCTGTTCTCATGATAGTGAATGG - Intergenic
927461598 2:23304111-23304133 GCTGTTCTCGTGATAGTGAAAGG - Intergenic
928214668 2:29351445-29351467 ACTGGTCCCTGGACAATGAAGGG - Intronic
928680542 2:33697718-33697740 GCTGTTCTCATGATAGTGAATGG + Intergenic
930457367 2:51622490-51622512 GCTGTTCTCATGAGAGTGAATGG - Intergenic
930579594 2:53194566-53194588 GCTGTTCTCGTGATAGTGAATGG - Intergenic
930688729 2:54336909-54336931 ACTGCTCTCTGCACAGTGATGGG + Intronic
932885083 2:75542045-75542067 GCTGTTCTCGTGATAGTGAATGG + Intronic
934576962 2:95408626-95408648 GCTGTTCTCATGATAGTGAATGG - Intronic
934639215 2:96017024-96017046 GCTGTTCTCATGATAGTGAATGG - Intergenic
934794434 2:97088387-97088409 GCTGTTCTCATGATAGTGAATGG + Intronic
935923509 2:108041432-108041454 GCTGTTCTCATGATAGTGAATGG + Intergenic
936289663 2:111211774-111211796 GCTGTTCTCCTGACAGTGAATGG + Intergenic
936659126 2:114522890-114522912 GCTGTTCTCATGAGAGTGAATGG - Intronic
936800714 2:116261531-116261553 GCTGTTCTCATGATAGTGAAAGG + Intergenic
938682196 2:133703238-133703260 ATTGTTGTGTGGACAGTGAATGG + Intergenic
939190479 2:138911890-138911912 GCTGTTCTCATGATAGTGAATGG - Intergenic
939436556 2:142184556-142184578 GCTGTTCTCATGATAGTGAATGG - Intergenic
940124858 2:150311644-150311666 AGTTTTCCCCGGACAGTGCAAGG + Intergenic
941123879 2:161562500-161562522 GCTGTTCTCATGATAGTGAATGG + Intronic
941140718 2:161777689-161777711 GCTGTTCTCGTGACAGTAAATGG - Intronic
941320034 2:164042445-164042467 GCTGTTCTCATGATAGTGAATGG - Intergenic
943123965 2:183773120-183773142 GCTGTTCTCCTGATAGTGAATGG + Intergenic
943447712 2:188009499-188009521 GCTGTTCTCGTGATAGTGAATGG - Intergenic
943707770 2:191053836-191053858 ACTGTTCTCCGGGCTGGGCACGG + Intronic
943878641 2:193108926-193108948 GCTGTTCTCGTGATAGTGAATGG + Intergenic
944451052 2:199842860-199842882 GCTGTTCTTAGAACAGTGAAAGG - Intronic
944721763 2:202429836-202429858 GCTGTTCTCATGACAGTGAGTGG - Intronic
944808732 2:203307646-203307668 GCTGTTCTCCTGATAGTGAATGG + Intergenic
945769362 2:214021486-214021508 GCTGCTCTCATGACAGTGAATGG - Intronic
946673027 2:222126859-222126881 GCTGTTCTCATGATAGTGAATGG - Intergenic
947021096 2:225676643-225676665 GCTGTTCTCGTGATAGTGAATGG - Intergenic
947296302 2:228634857-228634879 GCTGTTCTCATGATAGTGAATGG - Intergenic
947710702 2:232313915-232313937 GCTGTTCTCATGATAGTGAATGG - Intronic
947825023 2:233100006-233100028 TCTGTTCTCGTGATAGTGAATGG - Intronic
948037116 2:234866640-234866662 GCTGTTCTCATGACAGTGAGTGG - Intergenic
948851361 2:240708674-240708696 GCTGTTCTCGTGATAGTGAATGG - Intergenic
948878759 2:240844788-240844810 GCTGTTCTCCTGATAGTGAGTGG + Intergenic
1169836984 20:9891185-9891207 GCTGTTCTCATGATAGTGAATGG - Intergenic
1170037652 20:12005575-12005597 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1170710454 20:18786235-18786257 GCTGTTCTCATGATAGTGAATGG - Intergenic
1171415556 20:24978052-24978074 ACTGTTCTCCAGGCAGTGGGTGG - Intronic
1173098393 20:40060500-40060522 GCTGTTCTCATGATAGTGAATGG + Intergenic
1173143869 20:40508393-40508415 ACTGTTCTCCGGACAGACCCAGG + Intergenic
1173389666 20:42621006-42621028 GCTGTTCTCCTGATAGTGAATGG - Intronic
1174380185 20:50151291-50151313 GCTGTTCTTCAGAGAGTGAAGGG + Intronic
1174920260 20:54694553-54694575 ACTGTTCTCCTGAGAGTGAACGG - Intergenic
1176688910 21:9881008-9881030 GCTGTTCTCATGATAGTGAATGG - Intergenic
1176919518 21:14670225-14670247 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1177213641 21:18101125-18101147 GCTGTTCTCATGATAGTGAATGG + Intronic
1177266869 21:18797411-18797433 TCTGTTCTCATGATAGTGAATGG + Intergenic
1177333575 21:19694265-19694287 GCTGTTCTCGTGATAGTGAACGG + Intergenic
1177839419 21:26219128-26219150 GCTGTTCTCATGATAGTGAATGG + Intergenic
1177851172 21:26350390-26350412 GCTGTTCTCATGATAGTGAATGG + Intergenic
1177972892 21:27812223-27812245 ACTGTTCTCGTGATGGTGAATGG - Intergenic
1178143823 21:29716016-29716038 GCTGTTCTCATGATAGTGAATGG + Intronic
1183188329 22:36305298-36305320 GGTGTTTTCCGGAAAGTGAATGG + Intronic
1184450994 22:44582747-44582769 ACTGAGCTCTGGCCAGTGAAAGG - Intergenic
949139725 3:617647-617669 CCTGTTCTCCTGATAGTGAGTGG - Intergenic
949301819 3:2592518-2592540 GCTGTTCTCATGATAGTGAATGG + Intronic
951093212 3:18599039-18599061 GCTGTTCTCATGATAGTGAATGG - Intergenic
953358494 3:42274800-42274822 ACTGTTCTGGTAACAGTGAATGG - Intergenic
953461580 3:43085435-43085457 GCTGTTCTCGTGATAGTGAATGG + Intronic
953898152 3:46820011-46820033 GCTGTTCTCGTGATAGTGAATGG + Intergenic
954516798 3:51185724-51185746 GCTGTTCTCATGATAGTGAATGG + Intronic
954595644 3:51821705-51821727 GCTGTTCTCGTGACAGTAAATGG + Intronic
955502094 3:59595592-59595614 GCTGTTCTCATGATAGTGAATGG + Intergenic
956348729 3:68311134-68311156 GCTGTTCTCTTGATAGTGAATGG - Intronic
956938730 3:74132969-74132991 GCTGTTCTCCTGAGAGTGAATGG - Intergenic
956986879 3:74711815-74711837 ACTGTTCTCGTGACAGCGAGTGG - Intergenic
957240790 3:77658842-77658864 GCTGTTCTCGTGATAGTGAATGG - Intergenic
957247088 3:77729288-77729310 GCTGTTCTCGTGATAGTGAATGG + Intergenic
957759104 3:84532145-84532167 GCTGTTCTCGTGATAGTGAATGG + Intergenic
957924318 3:86789034-86789056 ATTGTTCCCCTGAAAGTGAAAGG + Intergenic
958525073 3:95246708-95246730 GCTGTTCTCGTGATAGTGAATGG + Intergenic
959054594 3:101554620-101554642 GCTGTTCTCATGATAGTGAATGG + Intergenic
959174052 3:102882697-102882719 GCTGTTCTCATGATAGTGAATGG + Intergenic
959196738 3:103192856-103192878 GCTGTTCTCGTGATAGTGAATGG - Intergenic
959216423 3:103455863-103455885 GCTGTTCTCGTGATAGTGAATGG + Intergenic
959741988 3:109731080-109731102 ACTGTTCTCATGACAGTGAATGG - Intergenic
960224423 3:115152695-115152717 GCTGTTCTCATGATAGTGAATGG + Intergenic
960478500 3:118159817-118159839 GCTGTTCTCAAGATAGTGAATGG - Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961067658 3:123890120-123890142 GCTGTTCTCATGATAGTGAATGG - Intergenic
962500338 3:135984969-135984991 CCTGTTCTCGTGACAGTGAATGG - Intronic
962916456 3:139908725-139908747 AGTGTTCTCCACTCAGTGAATGG + Intergenic
963280599 3:143381286-143381308 GCTGTTCTTGTGACAGTGAATGG + Intronic
963532297 3:146485932-146485954 GCTGTTCTCATGATAGTGAATGG - Intronic
964719231 3:159755415-159755437 GCTGTTCTCATGATAGTGAATGG - Intronic
964803307 3:160578471-160578493 GCTGTTCTCATGATAGTGAATGG + Intergenic
965198497 3:165628483-165628505 TCTGTTCTCATGACAGTGAATGG - Intergenic
965809491 3:172577357-172577379 GCTGTTCTTTTGACAGTGAATGG + Intergenic
965856157 3:173090197-173090219 ACTGTTCTCATGATAGTGAGTGG + Intronic
967255145 3:187583686-187583708 GCTGTTCTCCTGATAGTGAATGG - Intergenic
967505386 3:190247191-190247213 GCTGTTCTCATGATAGTGAATGG - Intergenic
969974316 4:11082325-11082347 GCTGTTCTCATGATAGTGAATGG + Intergenic
970329689 4:14966819-14966841 GCTGTTCTCATTACAGTGAATGG - Intergenic
970346853 4:15160562-15160584 AGTGTTCTGGGGACAGGGAAAGG + Intergenic
970769231 4:19590643-19590665 GCTGTTCTCTTGACAGTGACTGG - Intergenic
971299310 4:25428764-25428786 GCTGTTCTCATGATAGTGAATGG - Intergenic
971460634 4:26891978-26892000 GCTGTTCTCATGATAGTGAATGG + Intronic
972190784 4:36588045-36588067 ACTGTTCTCATGAAAGTGAATGG + Intergenic
972467376 4:39370250-39370272 GCTGTTCTCATGATAGTGAATGG + Intergenic
972987914 4:44787449-44787471 ATTGTTCTCGTGACAGTGAAGGG + Intergenic
973038696 4:45443128-45443150 GCTGTTCTCATGACAATGAATGG + Intergenic
974202669 4:58662078-58662100 GATGTTCTCCTGATAGTGAATGG - Intergenic
974476099 4:62382517-62382539 GCTGTTCTCGTGATAGTGAATGG - Intergenic
975390921 4:73816484-73816506 GCTGTTCTCATGATAGTGAATGG + Intergenic
975543178 4:75535150-75535172 GCTGTTCTCATGATAGTGAATGG - Intronic
976440529 4:85068356-85068378 GCTGTTCTTGTGACAGTGAATGG - Intergenic
976515830 4:85965294-85965316 GCTGTTCTCATGATAGTGAATGG - Intronic
977251126 4:94690561-94690583 ACATTTCTCTGGACTGTGAATGG - Intergenic
977369335 4:96115316-96115338 GCTGTTCACCTGACAGTGAATGG - Intergenic
977728727 4:100326716-100326738 GCTGTTCTCGTGATAGTGAATGG - Intergenic
978028053 4:103902315-103902337 GCTGTTCTCATGATAGTGAATGG - Intergenic
978059395 4:104317675-104317697 ACTGTTCTTGTGACAGTGAATGG + Intergenic
978392303 4:108240053-108240075 GCTGTTCTCGTGATAGTGAATGG - Intergenic
978704598 4:111691773-111691795 GCTGTTCTCATGATAGTGAATGG - Intergenic
979369086 4:119862278-119862300 GCTGTTCTCATGATAGTGAATGG - Intergenic
979390259 4:120119076-120119098 GCTGTTCTCATGATAGTGAATGG - Intergenic
979426547 4:120573660-120573682 GCTGTTCTCATGATAGTGAAGGG - Intergenic
980352295 4:131698822-131698844 GCTGTTCTCATGATAGTGAATGG - Intergenic
980388416 4:132115585-132115607 GCTGTTCTCATGATAGTGAATGG + Intergenic
982494298 4:156071146-156071168 GCTGTTCTCATGATAGTGAATGG - Intergenic
982758944 4:159257428-159257450 GCTGTTCTCATGATAGTGAATGG - Intronic
982901951 4:161017130-161017152 GCTCTTCTCATGACAGTGAATGG + Intergenic
982930483 4:161399899-161399921 ACATTTCTCTGGACTGTGAATGG + Intronic
983669214 4:170216117-170216139 GCTGTTCTCATGATAGTGAATGG + Intergenic
983869018 4:172803151-172803173 ACTGTTCTCAGAACAGTCCAAGG - Intronic
985475357 5:75741-75763 AGTGTTCTCTGGGCAGTGGACGG + Intergenic
985982735 5:3485764-3485786 AATGCTCTCAGGTCAGTGAAAGG - Intergenic
986756885 5:10845044-10845066 TCTGTTCTCATGATAGTGAATGG - Intergenic
986807346 5:11320695-11320717 GCTGTTCTCATGATAGTGAATGG - Intronic
987166624 5:15204629-15204651 GCTGTTCTCATGACAGTGAGTGG + Intergenic
988212817 5:28227918-28227940 GCTGTTCTCATGATAGTGAATGG + Intergenic
988822470 5:34901009-34901031 ACATTTCTCTGGACTGTGAATGG + Intergenic
988866811 5:35344126-35344148 GCTGTTCTCATGATAGTGAATGG - Intergenic
988888201 5:35582408-35582430 GCTGTTCTCATGATAGTGAATGG - Intergenic
988892338 5:35631236-35631258 GCTGTTCTCGTGATAGTGAATGG - Intronic
989675528 5:43968130-43968152 GCTGTTCTCATGATAGTGAATGG + Intergenic
991471094 5:66969863-66969885 AATGTTCTCCACAAAGTGAAAGG - Intronic
992826397 5:80553947-80553969 GCTGTTCTCGTGATAGTGAATGG + Intergenic
992854717 5:80848669-80848691 GCTGTTCTCATGACAGTGAATGG - Intronic
994352008 5:98756955-98756977 ACTGTTCTCGTGATAGTGAATGG + Intergenic
994614111 5:102081811-102081833 GCTGTTCTCATGATAGTGAATGG - Intergenic
994696204 5:103075560-103075582 GCTGTTCTCATGATAGTGAATGG + Intergenic
995830727 5:116352344-116352366 ACATTTCTCTGGACTGTGAATGG + Intronic
996297698 5:121942514-121942536 GCTATTCTCATGACAGTGAATGG - Intergenic
997007523 5:129836084-129836106 ATTGTTCTCCCTGCAGTGAAGGG - Intergenic
1000228980 5:159297572-159297594 ACTGTTCTCTTGATAGTGAATGG - Intergenic
1001005730 5:168048101-168048123 TCTCTTCTCAGAACAGTGAAGGG + Intronic
1001456256 5:171862615-171862637 ACTGTTGCCCTGACAGTGCATGG - Exonic
1003328033 6:5107589-5107611 GCTGTTCGGTGGACAGTGAACGG - Intronic
1003470395 6:6424587-6424609 ACTGTTCTTGTGATAGTGAATGG - Intergenic
1004703466 6:18101146-18101168 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1005331459 6:24754663-24754685 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1005601913 6:27434909-27434931 ACTGTCCTCTGCCCAGTGAATGG + Intergenic
1005794373 6:29342674-29342696 TCTGTTCTCATGACAGTGAGTGG - Intergenic
1006254035 6:32815043-32815065 CCTTTTCTCCCCACAGTGAAGGG + Exonic
1006280217 6:33046496-33046518 GCTGTTCTTGTGACAGTGAATGG + Intergenic
1008248330 6:49206823-49206845 GCTGTTCTCATGATAGTGAATGG - Intergenic
1009824923 6:68855990-68856012 GCTGTTCTCATGATAGTGAATGG + Intronic
1009876533 6:69512491-69512513 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1010396016 6:75392782-75392804 GCTGTTCTCATGATAGTGAATGG + Intronic
1010511949 6:76730584-76730606 GCTGTTCTCATGATAGTGAATGG + Intergenic
1011110761 6:83834529-83834551 GCTGTTCTCATGATAGTGAATGG + Intergenic
1012541421 6:100366347-100366369 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1013039768 6:106421947-106421969 GCTGTTCTCATGATAGTGAATGG - Intergenic
1013465611 6:110414786-110414808 ACTGTGCTTTGGACAGAGAAGGG - Intronic
1013927596 6:115492535-115492557 GCTGTTCTCATGATAGTGAATGG - Intergenic
1014067995 6:117149877-117149899 GCTGTTCTCATGATAGTGAATGG - Intergenic
1014068276 6:117151819-117151841 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1015194571 6:130510908-130510930 GCTGTTCTCCTGATAGTGAAGGG + Intergenic
1015217025 6:130762086-130762108 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1015660777 6:135571242-135571264 GCTGTTCTCATGATAGTGAATGG + Intergenic
1015873929 6:137803527-137803549 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1016537494 6:145125280-145125302 GCTGTTCTCATGATAGTGAATGG + Intergenic
1016537760 6:145127219-145127241 GCTGTTCTCATGATAGTGAATGG + Intergenic
1016625565 6:146163491-146163513 ACTGTACTCCGTACATTGAAAGG - Intronic
1016649467 6:146447665-146447687 GCTGTTCTCATGATAGTGAATGG - Intergenic
1016862155 6:148731469-148731491 GCTGTTCTCATGATAGTGAATGG + Intergenic
1017062140 6:150493732-150493754 ACTGTTCCCATGACAGTGAATGG + Intergenic
1017342173 6:153336507-153336529 GCTGTTCTCATGATAGTGAATGG + Intergenic
1017424608 6:154307254-154307276 GCTGTTCTCATGATAGTGAATGG + Intronic
1018582260 6:165317386-165317408 ACTCTTCTCAGCACAGTGCAGGG - Intergenic
1018857963 6:167689041-167689063 ACTGGTCTCCGGTCAGTGAATGG + Intergenic
1020581659 7:10010716-10010738 AGTGTTCTCATGACAGTGAGTGG + Intergenic
1021036712 7:15809109-15809131 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1021621464 7:22554309-22554331 GCTGTTCTCATGATAGTGAAGGG - Intronic
1022701818 7:32768592-32768614 ACTGTTCTTGTGATAGTGAATGG - Intergenic
1023188289 7:37553536-37553558 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1023709645 7:42977858-42977880 GCTGTTCTCATGACAGTGAGTGG + Intergenic
1024328202 7:48130146-48130168 TCTGTTCTCGTGATAGTGAATGG - Intergenic
1027968437 7:85043695-85043717 GCTGTTCTCGTGATAGTGAATGG + Intronic
1028042048 7:86064677-86064699 GCTGTTCTCATGATAGTGAATGG + Intergenic
1028359875 7:89955186-89955208 GCTGTTCTCATGATAGTGAATGG - Intergenic
1028360152 7:89957122-89957144 GCTGTTCTCATGATAGTGAATGG - Intergenic
1029525179 7:101089561-101089583 TCCGTTCTCCGGACAGTTAAAGG + Exonic
1030412946 7:109204557-109204579 CCTGTTCTCATGATAGTGAATGG - Intergenic
1030783011 7:113624985-113625007 GCTCTTCTCGTGACAGTGAATGG - Intergenic
1030904146 7:115162236-115162258 GCTGTTCTCATGATAGTGAATGG - Intergenic
1031177467 7:118371226-118371248 GCTGTTCTCGTGACAGTGAATGG - Intergenic
1031301488 7:120067027-120067049 GCTGTTCTCATGATAGTGAATGG + Intergenic
1031301745 7:120068955-120068977 GCTGTTCTCATGATAGTGAATGG + Intergenic
1033000755 7:137501934-137501956 GCTGTTCTCATGATAGTGAATGG + Intronic
1033249519 7:139746799-139746821 ACTGGACTCTGAACAGTGAAGGG - Intronic
1033805254 7:144946862-144946884 GCTGTTCTCATGATAGTGAATGG - Intergenic
1034052086 7:147994546-147994568 ACTGTTCTCATGATAGTGAATGG + Intronic
1034739551 7:153461434-153461456 ACTGTTCTCTTGGTAGTGAATGG + Intergenic
1035469690 7:159101763-159101785 ACTGTTCCTGTGACAGTGAACGG + Intronic
1036100902 8:5783585-5783607 ACTGTTCTCCTGGAAGTAAATGG + Intergenic
1036123291 8:6040907-6040929 GCTGTTCTCATGACAGTGAATGG - Intergenic
1036914409 8:12790900-12790922 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1037200855 8:16250538-16250560 GCTGTTCTTGTGACAGTGAATGG - Intronic
1037298643 8:17428060-17428082 GCTGTTCTCATGATAGTGAATGG - Intergenic
1039121804 8:34156409-34156431 GCTGTTCTCATGATAGTGAATGG + Intergenic
1039122080 8:34158350-34158372 GCTGTTCTCGTGACAGTGAATGG + Intergenic
1039148557 8:34478310-34478332 CCTGTTCTCCTGATAGTGAGTGG - Intergenic
1041443021 8:57918908-57918930 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1041860592 8:62508519-62508541 ACTGGTCCCCGGACAATGAGGGG - Intronic
1041953905 8:63536531-63536553 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1041953910 8:63536566-63536588 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1042684478 8:71422778-71422800 GCTGTTCTCCTGATAGTGATGGG - Intronic
1043080732 8:75761566-75761588 ACTGTTCTCGTAAAAGTGAATGG + Intergenic
1043492352 8:80762497-80762519 GCTGTTCTCGTGACAGTGAGTGG - Intronic
1045093268 8:98769351-98769373 GCTGTTCTCATGATAGTGAATGG + Intronic
1045249434 8:100471024-100471046 ACTGTTCTCATGATAGTGAATGG + Intergenic
1046061686 8:109147643-109147665 ACTTTTCTCAAGAGAGTGAAAGG + Intergenic
1046130575 8:109962933-109962955 ACTTGTCTCCGGATAGTGAATGG + Intergenic
1046851987 8:118984955-118984977 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1047149023 8:122240228-122240250 GCTGTTCTCATGATAGTGAATGG + Intergenic
1047920608 8:129630822-129630844 GCTGTTCTCATGACAGTGAATGG - Intergenic
1048027667 8:130601524-130601546 GCTGTTCTAGTGACAGTGAATGG + Intergenic
1048153919 8:131923000-131923022 AATGTTCTCCGCAGAATGAATGG + Intronic
1048769592 8:137881625-137881647 CTTGTTCTCCTGATAGTGAATGG + Intergenic
1048907559 8:139103193-139103215 GCTGTTCTCATGATAGTGAATGG - Intergenic
1051015989 9:12475802-12475824 GCAGTTCTCATGACAGTGAATGG + Intergenic
1051070181 9:13156542-13156564 GCTGTTCTCCTGATAGTAAATGG - Intronic
1051394601 9:16606487-16606509 GCTATTCTCTTGACAGTGAATGG + Intronic
1051560472 9:18435834-18435856 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1051743466 9:20273509-20273531 GCTGTTCTCATGATAGTGAATGG + Intergenic
1051837253 9:21354250-21354272 GCTGTTCTCATGATAGTGAATGG + Intergenic
1051957325 9:22712165-22712187 ACTGTTCTCATGATAGTGAATGG + Intergenic
1053118346 9:35525407-35525429 AGTGGTCTCCTGACAGTGTAGGG + Intronic
1053780417 9:41600892-41600914 GCTGTTCTCATGATAGTGAATGG + Intergenic
1053894511 9:42730124-42730146 GCTGTTCTCATGATAGTGAATGG - Intergenic
1054168359 9:61811049-61811071 GCTGTTCTCATGATAGTGAATGG + Intergenic
1054669170 9:67769769-67769791 GCTGTTCTCATGATAGTGAATGG - Intergenic
1055025310 9:71713232-71713254 GCTGTTCTCATGACAGTGAATGG + Intronic
1055083630 9:72291827-72291849 GCTGTTCTCATGATAGTGAATGG - Intergenic
1056103167 9:83319723-83319745 GCTGTTCTCTTGATAGTGAATGG + Intronic
1056475904 9:86950699-86950721 GCTGTTTTCATGACAGTGAATGG - Intergenic
1056651071 9:88463016-88463038 ACTGTTCTCTGGACTCTGATGGG + Intronic
1057425902 9:94949423-94949445 TCTGTCCTCCTGAGAGTGAAAGG - Intronic
1057982693 9:99677889-99677911 ACGTTTCTCTGGACTGTGAATGG + Intergenic
1058274703 9:103024924-103024946 GCTGTTCTCATGACAGTGAATGG + Intergenic
1058764625 9:108169370-108169392 ACTGTTCTTGTGATAGTGAATGG + Intergenic
1059040837 9:110814016-110814038 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1059474660 9:114535491-114535513 GCTGTTCTCCTGACAGTGAGTGG - Intergenic
1059721233 9:116962013-116962035 ACTGTTACCCGCATAGTGAATGG + Intronic
1060611200 9:124966464-124966486 ACACTTCTCTGGACTGTGAATGG + Intronic
1060706925 9:125811441-125811463 CCTGTTCTCATGATAGTGAATGG + Intronic
1061961155 9:133990062-133990084 ACTGTTCTCATGACAGAGATGGG + Intronic
1062251486 9:135597868-135597890 GCTGATCTCCTGACAGTGAATGG + Intergenic
1187030286 X:15480102-15480124 GCTGTTCTTGTGACAGTGAATGG + Intronic
1188029764 X:25251329-25251351 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1188912528 X:35866912-35866934 GCTGTTCTCTTGATAGTGAATGG + Intergenic
1188937100 X:36190095-36190117 ACTGTTCACCTGGGAGTGAAAGG + Intergenic
1189071156 X:37865793-37865815 GCTGTTCTCATGACAGTGAGTGG - Intronic
1189945175 X:46170674-46170696 GCTGTTCTCATGAGAGTGAATGG - Intergenic
1189945456 X:46172631-46172653 GCTGTTCTCGTGACAGTGAATGG - Intergenic
1190248181 X:48704551-48704573 ACTGTTCTCCAGGAGGTGAAGGG + Intronic
1193439118 X:81516455-81516477 GCTGTTCTCAGGATAGTGAGTGG + Intergenic
1193452039 X:81683550-81683572 GCTGTTCTCATGATAGTGAATGG + Intergenic
1193625381 X:83813856-83813878 GCTGTTCTCGTGGCAGTGAATGG + Intergenic
1193917503 X:87383090-87383112 GCTGTTCTCATGATAGTGAATGG + Intergenic
1194081740 X:89475519-89475541 ACTGTTCTCGTGATAGTGAATGG + Intergenic
1194269614 X:91794886-91794908 GCTGTTCTCATGATAGTGAATGG + Intronic
1194283677 X:91983638-91983660 ACTGTTCTCCTGACAGTGAATGG - Intronic
1194662253 X:96640024-96640046 CCTGTTCTCATGATAGTGAATGG + Intergenic
1195560565 X:106277640-106277662 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1195561397 X:106288699-106288721 GCTGTTCTCCTGATAGTGAATGG + Intergenic
1195670929 X:107469381-107469403 GCTGTTCTCATGATAGTGAATGG - Intergenic
1195788433 X:108554405-108554427 ACTGTTCTCCTGATAGTGAGTGG - Intronic
1196008188 X:110857397-110857419 GCTGTTCTCATGACAGTGAATGG + Intergenic
1196125329 X:112092711-112092733 ATTGTTCTCATGATAGTGAATGG + Intergenic
1196222703 X:113130105-113130127 ATTGTTCACCTAACAGTGAAGGG + Intergenic
1199100075 X:143789479-143789501 GCTGTTCTCTTGACAGTGAATGG - Intergenic
1199472388 X:148209428-148209450 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1199491162 X:148402280-148402302 GCTGTTCTCATGACAGTGAATGG - Intergenic
1199868647 X:151876895-151876917 GCTGTCCTCCTGATAGTGAATGG - Intergenic
1199934873 X:152562754-152562776 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1200434408 Y:3131709-3131731 ACTGTTCTCGTGATAGTGAATGG + Intergenic
1200586836 Y:5015867-5015889 GCTGTTCTCATGATAGTGAATGG + Intronic
1200601248 Y:5208202-5208224 ACTGTTCTCCGGACAGTGAATGG - Intronic
1201467017 Y:14293588-14293610 GCTGTTCTCATGATAGTGAATGG - Intergenic
1201924200 Y:19267109-19267131 GCTGTTCTCATGACAGTTAATGG - Intergenic