ID: 1200602162

View in Genome Browser
Species Human (GRCh38)
Location Y:5219038-5219060
Sequence CAGGATCTCCTTGTTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5739
Summary {0: 3, 1: 7, 2: 157, 3: 1134, 4: 4438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200602158_1200602162 8 Left 1200602158 Y:5219007-5219029 CCTCCATGTTCATCAATGTTGTC 0: 1
1: 14
2: 275
3: 1021
4: 2420
Right 1200602162 Y:5219038-5219060 CAGGATCTCCTTGTTTTTAAGGG 0: 3
1: 7
2: 157
3: 1134
4: 4438
1200602159_1200602162 5 Left 1200602159 Y:5219010-5219032 CCATGTTCATCAATGTTGTCACA 0: 2
1: 11
2: 276
3: 701
4: 1508
Right 1200602162 Y:5219038-5219060 CAGGATCTCCTTGTTTTTAAGGG 0: 3
1: 7
2: 157
3: 1134
4: 4438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200602162 Original CRISPR CAGGATCTCCTTGTTTTTAA GGG Intronic
Too many off-targets to display for this crispr