ID: 1200607928

View in Genome Browser
Species Human (GRCh38)
Location Y:5289542-5289564
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 2, 1: 1, 2: 2, 3: 13, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200607916_1200607928 25 Left 1200607916 Y:5289494-5289516 CCAGGGCTTTCAGAGGAAAGCAT 0: 2
1: 0
2: 0
3: 20
4: 227
Right 1200607928 Y:5289542-5289564 GGTGCACTCCAGGATCTGAGGGG 0: 2
1: 1
2: 2
3: 13
4: 160
1200607915_1200607928 26 Left 1200607915 Y:5289493-5289515 CCCAGGGCTTTCAGAGGAAAGCA 0: 2
1: 0
2: 0
3: 21
4: 290
Right 1200607928 Y:5289542-5289564 GGTGCACTCCAGGATCTGAGGGG 0: 2
1: 1
2: 2
3: 13
4: 160
1200607921_1200607928 0 Left 1200607921 Y:5289519-5289541 CCTTCAGCATCAGGGACATTGGG 0: 2
1: 0
2: 0
3: 17
4: 198
Right 1200607928 Y:5289542-5289564 GGTGCACTCCAGGATCTGAGGGG 0: 2
1: 1
2: 2
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900246996 1:1640937-1640959 GGGGCACGCCAGGGTCTGGGAGG - Intronic
900258218 1:1708069-1708091 GGGGCACGCCAGGGTCTGGGAGG - Intronic
901292090 1:8131975-8131997 GGTGGCCTCAAGGATCTGAAAGG + Intergenic
905229767 1:36507779-36507801 GGTCCACGCCAGGCTCAGAGGGG + Intergenic
908921645 1:69201460-69201482 AGGGAACTCCAGGATTTGAGAGG + Intergenic
910208911 1:84774613-84774635 GGTGCACCCCAGGCTGTGGGTGG + Intergenic
912522222 1:110253548-110253570 GGTGGTGTCCAGGCTCTGAGGGG + Intronic
914929104 1:151914153-151914175 GCGGCACTCCAGGAGCTGAAAGG - Intergenic
915587681 1:156852932-156852954 GCTGACCTCCAGGAGCTGAGTGG + Intronic
924183051 1:241458497-241458519 GTTCCACTCCACGATGTGAGAGG + Intergenic
1063299089 10:4835722-4835744 CCTGCACTCGAGGATGTGAGAGG - Exonic
1066068342 10:31778720-31778742 GGTGGCCTCCAGGAACTGGGAGG - Intergenic
1066431883 10:35359789-35359811 GGTGGTCACCAGGATCTGGGGGG - Intronic
1067784756 10:49237341-49237363 GGTGCACACCAGCATCTGCTAGG + Intergenic
1073116973 10:101096790-101096812 GGGGCACTCCAGAATCCCAGCGG - Intronic
1076012582 10:127002583-127002605 GGAGAACTCCAGGAGCTGGGGGG - Intronic
1076340806 10:129743628-129743650 GGTGCACTCCTGGACCTTTGGGG + Intronic
1076543242 10:131227548-131227570 GGTCCTTTCCGGGATCTGAGTGG - Intronic
1076545789 10:131245029-131245051 GGTGCCTTCCAGCAGCTGAGGGG - Intronic
1077301405 11:1848823-1848845 GGTGCAGACCTGGATTTGAGGGG - Intergenic
1077963153 11:7096883-7096905 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1078363841 11:10691045-10691067 GGGGCAGTCCAGGCTCTGTGAGG + Intronic
1078759193 11:14238203-14238225 GATGCAATCCATGATCAGAGAGG - Intronic
1079093716 11:17497691-17497713 TGTGCACTACATAATCTGAGGGG - Intronic
1079460067 11:20670787-20670809 GCTGCACCCCAGAATCTGTGTGG + Intronic
1081585890 11:44383388-44383410 GGAGGACTCCAGGAACTCAGTGG + Intergenic
1083345229 11:61984874-61984896 GGTGGTTTCCAGGAGCTGAGGGG - Intergenic
1083670609 11:64298015-64298037 GGTCCTCTCCAGGAACTGGGAGG + Intronic
1083774128 11:64884921-64884943 GGTGACCTCTAGGAGCTGAGAGG + Intronic
1085329459 11:75635942-75635964 GGTGCATTCTAGGATCTAAAGGG - Intronic
1086532883 11:87806968-87806990 GCTGCACACCAGGAGGTGAGTGG + Intergenic
1091076723 11:132625350-132625372 GAAGCAGTCCATGATCTGAGTGG + Intronic
1091355193 11:134932389-134932411 GGTGGTCTCCAGGATCTGGGAGG + Intergenic
1092006673 12:5076095-5076117 ATTCCACTCCAGGATGTGAGTGG + Intergenic
1092561399 12:9617970-9617992 GGTGATTTCCAGGAGCTGAGAGG - Intergenic
1096386954 12:51200395-51200417 GCTGCACTACAGGATCACAGGGG + Intronic
1101569406 12:105939286-105939308 GTTGCAGTTCAGGATCTCAGAGG + Intergenic
1102350932 12:112191521-112191543 GGGGCAGTGCAGGATGTGAGGGG - Intronic
1102525585 12:113510313-113510335 GATGAAATCCAGGCTCTGAGAGG + Intergenic
1104444095 12:128819866-128819888 GGTGCTCTCCAGGATATAACAGG - Intronic
1107990598 13:45815714-45815736 TGTTCACTCCATGATGTGAGAGG + Intronic
1111616096 13:90663588-90663610 GATGCACACTAGAATCTGAGAGG + Intergenic
1111847020 13:93523867-93523889 GGTGCACTGGAAGATTTGAGGGG + Intronic
1116869756 14:50059964-50059986 CATGCACTCCAGGCACTGAGGGG + Intergenic
1117417932 14:55515123-55515145 TGTGCATTACAGGATCGGAGAGG - Intergenic
1118102482 14:62622614-62622636 CTTGCATTCCAGGCTCTGAGAGG - Intergenic
1121109390 14:91302412-91302434 GCTGCTCTCCAGAGTCTGAGGGG - Intronic
1122393244 14:101404978-101405000 CGGGCACTCCAGGGTCCGAGAGG - Intergenic
1122787662 14:104171395-104171417 GCTGCTCTGCAGGACCTGAGCGG + Intronic
1122857944 14:104568891-104568913 GGTGCACCCCGGGGTCTGTGAGG + Intronic
1124139763 15:27067194-27067216 GTGGCACTCCAGGAGCCGAGTGG + Intronic
1125589263 15:40844365-40844387 GGAGCACCCCAGGATCGAAGAGG - Intronic
1125871803 15:43108956-43108978 GGTGGTTTCCAGGGTCTGAGAGG + Intronic
1129595254 15:76958856-76958878 GATGCACAGCAGGAGCTGAGTGG - Intergenic
1130540569 15:84818116-84818138 GGTCCTCCCCAGGACCTGAGTGG + Intronic
1132152865 15:99474971-99474993 GGGGCACTCCAGGCTCTGCGGGG - Intergenic
1135466014 16:22685564-22685586 GGTGGAATCCTGGCTCTGAGCGG - Intergenic
1136534865 16:30893571-30893593 GGTGCGCCCCAGGATCTGCAGGG - Intronic
1138132444 16:54492383-54492405 GCTGCACTCCAGCTTCAGAGAGG + Intergenic
1141565421 16:84898417-84898439 GGTGCAGTCAAGGAGCAGAGAGG - Intronic
1143322367 17:6076409-6076431 GGTGCACTCCAGGGACTGTGGGG + Intronic
1144844527 17:18209563-18209585 GCTGCCTTCCAGGATCTGAGTGG - Exonic
1145220633 17:21085737-21085759 CGTGCACTCCAGCATCCCAGAGG + Intergenic
1147188036 17:38723083-38723105 GGGAAACTCCAGGGTCTGAGTGG + Intronic
1147242499 17:39099626-39099648 GGTGGACTCCAGGATTTAAATGG + Intronic
1148494213 17:48042915-48042937 GGTGCACTTCAGGATGTGTGGGG - Intergenic
1150168964 17:62971695-62971717 GGTGCACAGCAGGAGGTGAGTGG + Intergenic
1150594196 17:66590031-66590053 GGTGCACAGCAGGAGGTGAGCGG - Intronic
1151500522 17:74485444-74485466 TGTGGACTCCTGGATCTGAAAGG + Intergenic
1155864058 18:30942264-30942286 GGATCACTCCAGGATCTGGCTGG - Intergenic
1156468567 18:37363137-37363159 GGTGCACTACAGGGTCTGCTGGG + Intronic
1157499719 18:48181131-48181153 GGGTGACTCCAGGATCTCAGTGG - Intronic
1157878667 18:51297692-51297714 TGTTAACTCTAGGATCTGAGTGG - Intergenic
1159893445 18:73974312-73974334 GGAGCGCTGGAGGATCTGAGTGG + Intergenic
1161068086 19:2248141-2248163 GGTGGACTCCAGGAGCTGGGGGG - Exonic
1161068214 19:2248438-2248460 GGTGCACCCCAGGATTTGAGGGG - Exonic
1161382245 19:3971481-3971503 GGTCCACTCCAGGAGCTGCCAGG - Intergenic
1161896924 19:7089503-7089525 GCTGCATTCCAGGAGCTGACAGG + Intergenic
1162798841 19:13100079-13100101 GGTGTACTCATGGGTCTGAGAGG + Intronic
1163375473 19:16927688-16927710 GGTTCACTGCAGGTTCTTAGGGG + Intronic
1163533369 19:17863376-17863398 GCTGCACCCCAGGAGCTGACTGG - Intronic
1165845042 19:38812753-38812775 GGGGCCCCCCAGGATCAGAGTGG + Intronic
1166533139 19:43554417-43554439 GGTGAACTGCAGCATCTCAGAGG - Intronic
1166615092 19:44236611-44236633 GGTGGACTCGAAGATTTGAGGGG - Exonic
1167343440 19:48930177-48930199 GCTGCACTCCAGCACCTCAGAGG - Intergenic
926121321 2:10242696-10242718 GGTGCACCCCAGGCTCCAAGGGG - Intergenic
926330689 2:11822807-11822829 GAGGGACTCCAGCATCTGAGAGG + Intronic
928592068 2:32827463-32827485 TGTGCACTCCCAGGTCTGAGTGG - Intergenic
930301221 2:49618472-49618494 GGTGCTTTCCTGGATCTGGGTGG - Intergenic
934682567 2:96295563-96295585 GGTGCAGACGATGATCTGAGTGG + Exonic
935216095 2:100976349-100976371 GGTGGACTCCAGGTTCCAAGAGG + Intronic
942749407 2:179270653-179270675 GGTGCACAGCAGGAGGTGAGTGG - Intergenic
944650638 2:201826932-201826954 GGAGAAATCCAAGATCTGAGAGG + Intronic
946428796 2:219613789-219613811 GTTCCCCTGCAGGATCTGAGTGG + Exonic
947837813 2:233188118-233188140 GGGGGACTCCAGGATCAGAGAGG - Intronic
948056370 2:235011900-235011922 GCTGCATTCCAGGCTCTGGGTGG + Intronic
948080646 2:235202711-235202733 AGAGCACCCCAGGAGCTGAGTGG - Intergenic
948206081 2:236163565-236163587 GGGGCACTCCAGGATCTGCGGGG + Intergenic
948237849 2:236403815-236403837 GGAGGACTCAAGGATCTCAGAGG - Intronic
1169116876 20:3071859-3071881 TGAGAACTCCAGGAGCTGAGCGG + Intronic
1170744025 20:19082079-19082101 GGTGCACAGCAGGAGGTGAGAGG + Intergenic
1175287820 20:57849587-57849609 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1178436867 21:32567530-32567552 GGTGCACTATAGGATCTGAAGGG + Intergenic
1182126981 22:27822972-27822994 AGTGCTCTCCTGGTTCTGAGGGG - Intergenic
1182853742 22:33499163-33499185 GGTGGACTCTAGGGTCAGAGTGG + Intronic
1182983887 22:34698516-34698538 GGTGCTCTCCAGGAGCTAAAAGG - Intergenic
1183614948 22:38938395-38938417 GGCGAACTCCAGGACCGGAGAGG + Intergenic
1183700165 22:39446506-39446528 GCTGCACTCCAGAGTCTGTGAGG - Intergenic
1184550060 22:45199716-45199738 GCAGCCCTCCAGGAGCTGAGGGG - Intronic
1184858809 22:47161672-47161694 GGTGCACACCTGGAAATGAGTGG + Intronic
1184983344 22:48112179-48112201 AGTGCTTTCCAGGAGCTGAGAGG + Intergenic
954129026 3:48550368-48550390 GGGCCACTCCAGGAGCTGTGTGG - Intronic
955819875 3:62885431-62885453 AGTGCATTCCAGGACCTCAGAGG + Intergenic
956176474 3:66477851-66477873 GATGCACTACAGGATAGGAGTGG + Intronic
959204519 3:103288157-103288179 GGTGATTTCCAGGATCTGAGGGG - Intergenic
960141100 3:114152672-114152694 GGGGCTCTCCAGGCTCTGTGGGG + Intronic
961317450 3:126050267-126050289 GGTGTGTTCAAGGATCTGAGAGG - Intronic
963154546 3:142082010-142082032 GATGCACTGCAGGAGGTGAGTGG + Intronic
965680571 3:171247228-171247250 ACTGCAATCCTGGATCTGAGTGG - Intronic
968205517 3:196796115-196796137 GCTGCACGGCAGGAACTGAGTGG - Intronic
968744391 4:2352238-2352260 GGAGCACACCTGGATCTGCGGGG + Intronic
970942450 4:21650917-21650939 GGTGGCCTCAAGGAGCTGAGTGG - Intronic
973145497 4:46820418-46820440 GCTGCACTGCAGGAGGTGAGAGG - Intronic
980972078 4:139576328-139576350 GGAGCTCTCCAGGCTCTGTGAGG - Intronic
981110788 4:140930919-140930941 GTTGCACTCCTGGATCTGCTGGG + Intronic
981182385 4:141761032-141761054 GGTCAACTTCAGGCTCTGAGAGG - Intergenic
984128006 4:175836206-175836228 AGTGCACTCCAGGTTGAGAGAGG - Intronic
985671736 5:1210312-1210334 GGGCTACTCCAGAATCTGAGGGG - Intronic
987393904 5:17402835-17402857 GGTCCACTCCAGGACCTGCCAGG + Intergenic
992173573 5:74127613-74127635 GGCTCCCTCCAGGATCAGAGAGG + Intergenic
994402951 5:99305282-99305304 GATGCATTCCAGTTTCTGAGTGG + Intergenic
997401636 5:133607969-133607991 GGTGCTCTCCGTGAGCTGAGGGG - Intronic
997443849 5:133927205-133927227 GCTGCCCTCCTGGAGCTGAGTGG - Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
999152209 5:149433807-149433829 TGTGCATCCCAGGAGCTGAGAGG + Intergenic
999262747 5:150247689-150247711 GGGGCACTCCAATATCTGACAGG + Intronic
1001066361 5:168537933-168537955 GGTGCACTGCAGTCTCTGAAGGG - Intergenic
1002323595 5:178390381-178390403 GGTGCACTCCAGGCTCAGTGTGG + Intronic
1005856894 6:29869618-29869640 GGTGCCCTCCAGGATCTTCTGGG + Intergenic
1010717478 6:79246132-79246154 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1013385469 6:109625473-109625495 GGGGCACTGCAGGAGGTGAGCGG + Intronic
1015646197 6:135391506-135391528 GGTGCACAGCAGGAGGTGAGTGG - Intronic
1017188032 6:151622392-151622414 GCTGCAGTCTAGGATGTGAGTGG - Intergenic
1019481235 7:1267706-1267728 GGCCCACTCCAGGATGTCAGGGG - Intergenic
1019635886 7:2075335-2075357 GGTGCCCTGCAGGGCCTGAGGGG - Intronic
1019697120 7:2452111-2452133 GGGGGACTCAAGGAGCTGAGTGG + Intergenic
1022805140 7:33814026-33814048 GGAACACCCCAGGAACTGAGTGG - Intergenic
1024502468 7:50125803-50125825 GGTGGTTTCCAGGAGCTGAGGGG + Intronic
1027180988 7:75939138-75939160 GCTGCACTCCAGGAACTGTGTGG - Intronic
1030407573 7:109133447-109133469 GGTCCACTGCAGGATCTCAGGGG - Intergenic
1033714303 7:143983931-143983953 GGTGGCCTCCAGGAGCTTAGAGG - Intergenic
1033796706 7:144853877-144853899 GGTGCACCCGAGGAACTGAAAGG - Intergenic
1035286099 7:157808163-157808185 GGTGCACAGCAGGAGGTGAGTGG + Intronic
1035453414 7:158993780-158993802 GGTGCACATCAGGAGGTGAGTGG + Intergenic
1038253154 8:25925302-25925324 GGTGCACAGAAGGAGCTGAGAGG + Intronic
1039448176 8:37648978-37649000 GGTGCCCTCCGGGCTCTGCGTGG + Intergenic
1048169718 8:132094563-132094585 GGTGACCTTCAGGATGTGAGGGG - Intronic
1049169652 8:141151611-141151633 GATGCATGTCAGGATCTGAGGGG - Exonic
1049222166 8:141433138-141433160 GGGGCTCTCCAGGAGCTGTGTGG + Intergenic
1053753725 9:41280940-41280962 GGTGCCCTCCAGGAACCAAGGGG + Intergenic
1054259248 9:62845300-62845322 GGTGCCCTCCAGGAACCAAGGGG + Intergenic
1054332531 9:63774737-63774759 GGTGCCCTCCAGGAACCAAGGGG - Intergenic
1057266649 9:93621925-93621947 GGTGCACCACAGGAGCTGAAGGG - Intronic
1057438853 9:95067143-95067165 GTGGCACACCAGGATGTGAGAGG + Intronic
1061727019 9:132587599-132587621 GGTCCCCTCCAGGAGCTGTGAGG - Intronic
1202799538 9_KI270719v1_random:163048-163070 GGTGCCCTCCAGGAACCAAGGGG - Intergenic
1185460579 X:331234-331256 GCTGCTCCCCAGGCTCTGAGTGG + Intergenic
1185980151 X:4770422-4770444 GGTGCACTGCAGGATTTAATTGG + Intergenic
1187265814 X:17732115-17732137 GGGGCTCTTCAGGATCTCAGTGG - Exonic
1194290415 X:92064943-92064965 GGTGCACTCCAGGATCTGAGGGG + Intronic
1194601841 X:95931009-95931031 GGTCCACTCCAGTATGTAAGAGG + Intergenic
1196023920 X:111020375-111020397 GGTGGTTTCCAGGAGCTGAGAGG + Intronic
1197367966 X:125589693-125589715 GCTGCCTTCCAGGATCTGAGTGG - Intergenic
1197729194 X:129795561-129795583 GGAGCTGTCCAGGATCTAAGAGG + Intergenic
1198088761 X:133306639-133306661 GGTGCACTCAAGGATCTGAGGGG - Intronic
1198741213 X:139845061-139845083 GGTGCACTAGAGAAACTGAGAGG - Intronic
1200607928 Y:5289542-5289564 GGTGCACTCCAGGATCTGAGGGG + Intronic
1200922887 Y:8628824-8628846 GGAGCACTCCATGTTCTGGGTGG + Intergenic