ID: 1200608157

View in Genome Browser
Species Human (GRCh38)
Location Y:5292207-5292229
Sequence CTTTTTTTGATACGTTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200608157 Original CRISPR CTTTTTTTGATACGTTTGTC TGG Intronic
903025131 1:20423502-20423524 TTTTTTGTGATATGTTTGTCTGG - Intergenic
903161377 1:21491448-21491470 TTTTTTTTGCTCCCTTTGTCAGG - Intergenic
903633315 1:24794453-24794475 CTTTTTTTCATATGCTTGTTGGG + Intronic
906053520 1:42895034-42895056 CATTTTTTCATATGTTTGTTGGG + Intergenic
906272479 1:44491263-44491285 TTTTTTGTGATATGTTTGCCTGG - Intronic
908005719 1:59726389-59726411 CTTTTTTTAATGTCTTTGTCTGG + Intronic
909309296 1:74125828-74125850 CTTTTTCTGATTCTTTTATCAGG + Intronic
910190916 1:84594714-84594736 CTTCTTTTCATATGTTTGTTGGG - Intergenic
911353692 1:96789643-96789665 CTTTCTTTGTTACATTTGTATGG + Intronic
911714647 1:101117242-101117264 CTTTATTTGATACATTGGGCTGG + Intergenic
911718202 1:101159794-101159816 CTCTTTTTGATACGGTTGTTTGG + Intergenic
911806036 1:102209919-102209941 CTTTTTTTGATAAATTTTCCAGG + Intergenic
911970237 1:104425733-104425755 CTTTTTTTGATGTGTTAGTATGG - Intergenic
911991409 1:104702296-104702318 TTTTTTTTGGTAAGTTGGTCTGG - Intergenic
912632896 1:111263183-111263205 CTTTTTTTGATGTGTCTGTCTGG + Intergenic
913201307 1:116496942-116496964 CCTTTTTTGATAGGGTGGTCAGG - Intergenic
915770089 1:158412112-158412134 TTTGTTTTGATACCTGTGTCAGG - Intergenic
916863381 1:168830955-168830977 CTGTTTTCAATAGGTTTGTCAGG + Intergenic
916906027 1:169284353-169284375 CTTTTTTTCATGTGTTTGTTGGG + Intronic
917245978 1:173001158-173001180 CTTTTTTTGATGTGTCTGTTTGG + Intergenic
918273176 1:182923395-182923417 CTTTTTTTGATGCTTCTGCCAGG - Intronic
919154374 1:193742934-193742956 CTTGTTTTCATATGTTTGTTGGG + Intergenic
919321806 1:196051089-196051111 CTTTTTTGGATATTTTTTTCTGG + Intergenic
919486592 1:198155352-198155374 CTATTTTAAATATGTTTGTCTGG - Intergenic
920063140 1:203242346-203242368 CTTTTTTTCATATGTTTGGTTGG + Intronic
923347068 1:233064753-233064775 CATTTTTTGATACTTTTAGCAGG + Intronic
924767943 1:247051600-247051622 CTTTTTGTGATACATTTTCCAGG + Intronic
924788851 1:247225045-247225067 CTTTTTTTCATATGTTTGTTGGG - Intergenic
1064078941 10:12292745-12292767 TTTTATCTGATACGTTTTTCTGG + Intergenic
1067919920 10:50444308-50444330 CTTCTTTTATTATGTTTGTCTGG - Intronic
1068172632 10:53415789-53415811 ATTTTTTTCATACGTTTCTTGGG + Intergenic
1068404213 10:56569313-56569335 CTTTTCTTCATACGTTTGTTTGG + Intergenic
1068844021 10:61650378-61650400 CTTTTTTTGATGTCATTGTCTGG + Intergenic
1069576408 10:69532906-69532928 CATTTTTTCATATGTTTGTTGGG - Intergenic
1070022962 10:72605041-72605063 CTTGTTTTGAGAAGTTTGGCAGG + Intronic
1070091304 10:73288191-73288213 ATGTTTTTGATATGTTTGGCCGG - Intronic
1071005169 10:80875778-80875800 CTTTTTTTTATATGTTTGTTGGG + Intergenic
1071926162 10:90411866-90411888 CTGTTTTTTATATGTCTGTCAGG - Intergenic
1072493923 10:95935789-95935811 CTATTTTAGATAGGGTTGTCAGG - Intronic
1074063074 10:109985716-109985738 CATTTTTTCATATGTTTGTTTGG + Intergenic
1076186789 10:128456642-128456664 TTTTTTTTTATTAGTTTGTCTGG - Intergenic
1078770494 11:14346476-14346498 CTTTATTTGTTATCTTTGTCTGG - Intronic
1079199054 11:18358940-18358962 TTATATTTGATACGTTTTTCAGG + Intronic
1079625686 11:22614400-22614422 TTTTTTTTGATATGTCTGTCTGG + Intergenic
1080085430 11:28275628-28275650 TTTTTTTTGGTATCTTTGTCTGG - Intronic
1080300128 11:30775034-30775056 CTTCTTTTCATACGTTTCACAGG + Intergenic
1081217392 11:40418339-40418361 CTTTTTTTCATATGTTTGTTGGG - Intronic
1081711313 11:45217820-45217842 CTTTTCTTTATATGTGTGTCAGG + Intronic
1083007350 11:59359406-59359428 CTATTTTTGATGCATTTTTCAGG - Intergenic
1085498186 11:76992034-76992056 CTTTTTTTGCTATGTTTCCCAGG - Intronic
1089722540 11:120441143-120441165 CTTTTTGTAATACCTTTGTCTGG + Intronic
1093141559 12:15515954-15515976 TTTTTTTTGTTTTGTTTGTCTGG + Intronic
1093544561 12:20331404-20331426 CTTTTTTTCATATGTTTTTTTGG + Intergenic
1093791971 12:23262645-23262667 GTTTTTTTGAAACTTTTGTTTGG - Intergenic
1093837848 12:23858421-23858443 CTTTTTTTCATATGCTTGTTGGG - Intronic
1093909975 12:24735482-24735504 CTTTTCTGGATACGTGTCTCTGG - Intergenic
1095228567 12:39705491-39705513 CTTTTCTTGATGTCTTTGTCTGG - Intronic
1095416812 12:41986281-41986303 CTTTTTTTCATATGTTTGTTTGG - Intergenic
1095638237 12:44456504-44456526 CTTTTCTTGATACGTTTAGTTGG - Intergenic
1097994129 12:65869148-65869170 CTTTTTTTGGTAGGGTTCTCTGG + Intronic
1098660371 12:73086601-73086623 TTTCTTTTAATATGTTTGTCTGG - Intergenic
1099495576 12:83342141-83342163 TTTTTTTTGATGTCTTTGTCTGG - Intergenic
1104199275 12:126572182-126572204 TTTTTTTTGATATACTTGTCAGG + Intergenic
1104786283 12:131451129-131451151 TTTTTTGTAATACTTTTGTCTGG + Intergenic
1104796380 12:131522301-131522323 CTTTTTTTCATATGTTTGTTTGG + Intergenic
1108151201 13:47536552-47536574 CTTTTTTCCATATGTTTGTTGGG - Intergenic
1108469034 13:50749700-50749722 CATTTTTTCATACATTTGTTTGG + Intronic
1109427032 13:62178633-62178655 CTTTTTTTCATATATTTGTTGGG - Intergenic
1109884692 13:68526818-68526840 CTTTTTTTGTTGTGTCTGTCAGG - Intergenic
1110319969 13:74149974-74149996 CTATTTTTGAAAAGGTTGTCTGG - Intergenic
1110453200 13:75660420-75660442 CTTTTTTTGATATGTTTGCAGGG + Intronic
1111038202 13:82706762-82706784 CTTTTTTTCATGTGTTTGTTGGG + Intergenic
1111531109 13:89539124-89539146 TTTTTTTTGATGTTTTTGTCTGG + Intergenic
1111752511 13:92352207-92352229 ATTTTTTTCATATGTTTTTCAGG - Intronic
1112601840 13:100863861-100863883 TTTCTTGTGATACCTTTGTCTGG + Intergenic
1113317810 13:109202466-109202488 CATTTTTTCATATGTTTGTTGGG + Intronic
1115058539 14:29162103-29162125 CTGTTTATGATAGGTTTATCAGG - Intergenic
1115538804 14:34399739-34399761 TTTTTTTTGATGTCTTTGTCTGG - Intronic
1116149238 14:41117464-41117486 CTTTTTTTAATGTGTCTGTCTGG - Intergenic
1116227810 14:42174313-42174335 CTTTTATTGATTTGTATGTCTGG - Intergenic
1116252892 14:42509369-42509391 CTTTTTTTCATATGCTTGTTGGG - Intergenic
1116471915 14:45295450-45295472 CTTTTTTTCATATGTTTTTTTGG - Intergenic
1117559787 14:56925299-56925321 TTTTTTTTTATACATTTATCAGG + Intergenic
1118960722 14:70528334-70528356 CTTTTTTAGATATGGTTGTGAGG + Intronic
1119998241 14:79276804-79276826 ATTTTGCTGATGCGTTTGTCTGG - Intronic
1120064068 14:80019126-80019148 CTTTTTTTCATATGTTTTTTTGG + Intergenic
1120224013 14:81769872-81769894 CATTTTTTGATGGGTTTGTTTGG - Intergenic
1120807108 14:88764209-88764231 CTTTTCTTCAAATGTTTGTCTGG + Intronic
1121131482 14:91451565-91451587 CTTCTTGTGATATCTTTGTCTGG + Intergenic
1123975505 15:25550263-25550285 CTTTTTGTACTGCGTTTGTCTGG - Intergenic
1125214578 15:37256118-37256140 CTTTTTTTGATATATTTTTCTGG - Intergenic
1125418922 15:39483604-39483626 CTTTTTCTCATGCCTTTGTCTGG - Intergenic
1125994670 15:44146757-44146779 CTTTTTTTCATATGTTTGTTGGG + Intronic
1129436910 15:75548947-75548969 CTTTTTTTGAAATTTTTGGCTGG - Intronic
1130826605 15:87553626-87553648 TTTTTTCTGTTACGTCTGTCTGG + Intergenic
1131421777 15:92312377-92312399 TTGTTTTTGATATATTTGTCTGG - Intergenic
1134424172 16:14123553-14123575 CTTGTTTGTATAGGTTTGTCAGG + Intronic
1135253858 16:20924604-20924626 CTTTTTAAGACAAGTTTGTCTGG - Exonic
1138508346 16:57491052-57491074 CTTTTTGTGCTACCTTTATCTGG + Intergenic
1138678555 16:58669080-58669102 CTTTTTTAGACATGTTTGTATGG + Intronic
1140059097 16:71552282-71552304 TTTTGTGTGATATGTTTGTCTGG - Intronic
1140557887 16:75942545-75942567 CTGTTTGTGATAAGCTTGTCAGG + Intergenic
1141262970 16:82470398-82470420 CTTTTGTTGTTATATTTGTCAGG + Intergenic
1142839263 17:2614035-2614057 TTTTTTTTGAGACGTGGGTCTGG + Intronic
1145297755 17:21606518-21606540 TTTTTTTTGATGCTATTGTCTGG - Intergenic
1145352503 17:22096904-22096926 TTTTTTTTGATGCTATTGTCTGG + Intergenic
1146039823 17:29441143-29441165 CTTCTTGTGATATCTTTGTCTGG + Intronic
1146583834 17:34064758-34064780 CATTTTTTCATATGTTTGTTGGG - Intronic
1146766683 17:35529074-35529096 CTTTTTTTCATATGTTTGTTGGG - Intronic
1150523178 17:65891060-65891082 CTTTTTTATATACGTAGGTCCGG + Intronic
1151639564 17:75380723-75380745 CCTTTTTTTATAGCTTTGTCAGG - Intronic
1152981916 18:286308-286330 ATTTATTTGATAAGTGTGTCAGG + Intergenic
1154111852 18:11576848-11576870 CTTTTTCTGCGATGTTTGTCAGG - Intergenic
1154288859 18:13087008-13087030 CTTTTTTAGATACCTTTGTCTGG + Exonic
1157507828 18:48242948-48242970 CTTTTTTTGATAAGTCTTTAGGG - Intronic
1157999974 18:52607024-52607046 ATTTTTTTGCTATATTTGTCAGG + Intronic
1158377387 18:56886130-56886152 CTTTTTGTGATAAATTTCTCAGG - Intronic
1159708762 18:71726925-71726947 ATTTTTTTTATAGGTTTTTCAGG - Intergenic
1162715900 19:12633227-12633249 CTTTTTTTTATAATTCTGTCTGG + Intronic
1165965732 19:39578169-39578191 CTTTTCTTCATATGTTTGTTGGG + Intergenic
925553503 2:5102494-5102516 TTTCTTGTGATATGTTTGTCTGG + Intergenic
925658980 2:6182750-6182772 CTTTTTATGATACGATGGGCTGG + Intergenic
927069793 2:19515948-19515970 CTTTTTGTGATAAGTTTCCCAGG + Intergenic
927756412 2:25711792-25711814 TTTTTTGTGATACCTTTGTCTGG - Intergenic
928014658 2:27644543-27644565 TTTTTTTTTATAGATTTGTCTGG + Intronic
931025667 2:58111271-58111293 CTTTTTTTTATAACTTTGTGAGG - Intronic
931743316 2:65268670-65268692 CTTTTCTTGGTACTCTTGTCGGG - Exonic
932636759 2:73396398-73396420 TTTCTTTTGATGCTTTTGTCTGG + Intronic
932992902 2:76809951-76809973 ATTTTTTTTATAGGTTGGTCAGG - Intronic
933140375 2:78784982-78785004 TTTATTTTGTTACATTTGTCAGG + Intergenic
934911451 2:98259222-98259244 TTTTCTTTGACATGTTTGTCTGG + Intronic
936736902 2:115456189-115456211 CTTTTTTTCATATGTTTGATGGG - Intronic
937617934 2:123948405-123948427 CTCTTTTTGATTTGTTAGTCTGG - Intergenic
939841086 2:147187750-147187772 CTTTTTTTAATATGTTTCTTGGG - Intergenic
940354990 2:152730874-152730896 CTTTTCTAGATGCTTTTGTCAGG + Intronic
940723966 2:157313791-157313813 CTTTATATAATAAGTTTGTCAGG - Exonic
941189568 2:162362892-162362914 CATTTTTTGTTACTTTTTTCTGG - Intronic
941825833 2:169895376-169895398 CTTTTTTTGATATATTTCTCAGG + Intronic
942152323 2:173089310-173089332 CTTTTTTGGATGTGTGTGTCGGG + Intronic
943057417 2:182999372-182999394 CATTTTTTCATATGTTTGTTGGG - Intronic
943316757 2:186398210-186398232 CTTTTTTTGTTGTGTCTGTCAGG + Intergenic
944791429 2:203132186-203132208 GTTTTTTTCATACCTTTCTCAGG + Intronic
946829152 2:223710437-223710459 CATTTTTAGATACTTTTCTCTGG - Intergenic
947005394 2:225505715-225505737 CTTTTCTCAATACATTTGTCAGG + Intronic
947130650 2:226920821-226920843 TTTTCTTTGATATCTTTGTCTGG + Intronic
1169877373 20:10312820-10312842 CTATGTTTCATACCTTTGTCAGG + Intergenic
1170592526 20:17781777-17781799 CTTTTTTTGGTACGTTAGAAAGG + Intergenic
1173318438 20:41965840-41965862 CTTTTTTTCACATGTTTGTTGGG + Intergenic
1174370796 20:50086043-50086065 CTGTTTTTAAGACGTTGGTCTGG - Intronic
1174647747 20:52100640-52100662 CTTTTATTGAGAAGTTTGTGCGG + Intronic
1176358288 21:5970921-5970943 TTTTTTTTGAGAAGTTTGGCTGG + Intergenic
1176880778 21:14190495-14190517 CTTGTTTTGCTATGTTTTTCTGG - Intronic
1177509074 21:22060091-22060113 CTTTTTTTCATATGTTTGTTGGG - Intergenic
1178629886 21:34250365-34250387 CTTTATTTGATGCTTTTCTCTGG + Intergenic
1179765230 21:43567629-43567651 TTTTTTTTGAGAAGTTTGGCTGG - Intronic
1182471728 22:30552998-30553020 CTTTATTTGAGACCTGTGTCAGG - Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1183543691 22:38444348-38444370 CTATTTTTGACACGGTAGTCAGG + Intronic
1184816347 22:46874527-46874549 CTTTTTTTCATATGTTTGTTTGG + Intronic
949210127 3:1488727-1488749 TTTTTTAGGATAGGTTTGTCTGG - Intergenic
949921194 3:9003111-9003133 TTTCTTGTGATACCTTTGTCTGG - Intronic
951450442 3:22831635-22831657 CTTTTTTTCATATGTTTGTTGGG - Intergenic
951456333 3:22896302-22896324 CTTTTTTTGAGACGCTTTTTTGG + Intergenic
952121985 3:30256163-30256185 TTTTTTTTCATATGTTTGTTGGG + Intergenic
952477481 3:33725852-33725874 ATGTTTTTGATACATTTGACAGG - Intergenic
955300974 3:57778961-57778983 ATTTTTTTTATATGTTTGCCAGG + Intronic
955370986 3:58351675-58351697 TTTTTTTTCCTACGTTTTTCAGG - Intronic
955816827 3:62852582-62852604 CTTTTTTTGATAAGTCTCTCTGG - Intronic
955841800 3:63120551-63120573 CTATTTTAGGTACGGTTGTCAGG + Intergenic
956227548 3:66976734-66976756 TTTTTTTTGATGGGTTTGTCAGG + Intergenic
956674820 3:71724471-71724493 CTATTTTAGATACGGTAGTCAGG + Intronic
957811685 3:85229815-85229837 CTTTCTTGGCTCCGTTTGTCAGG + Intronic
958003395 3:87780451-87780473 TTTTTTATGATACCCTTGTCTGG - Intergenic
958694091 3:97505947-97505969 CTTTTTTTCATGTGTTTGTTTGG + Intronic
958821145 3:98975290-98975312 CTTTTCTTCATATGTTTGTTGGG - Intergenic
959349678 3:105246333-105246355 CTTTTATCGATACATTTGTGTGG + Intergenic
959875566 3:111378548-111378570 CTATTTTTGATAGGATTGTTTGG - Intronic
959919753 3:111857683-111857705 CTTTTTTTCATATGTTTGTTAGG - Intronic
962125701 3:132615054-132615076 CTTTTTTTCATATGTTTGTTGGG - Intronic
962466541 3:135665053-135665075 TTTTTTTTGATGTGTCTGTCCGG - Intergenic
963448414 3:145444235-145444257 CTTTTTTTGATGTGACTGTCAGG - Intergenic
963514798 3:146294614-146294636 CTTTTTTTGGTATGTCTGTCTGG + Intergenic
963711389 3:148751583-148751605 CTTTTTGTGATTCATCTGTCTGG - Intergenic
965579863 3:170256143-170256165 CTCTTTTTGACATATTTGTCTGG + Intronic
970411640 4:15814209-15814231 CTTTTTTTCATATGTTTGCTGGG + Intronic
970984064 4:22135038-22135060 GTTTCTTTGATATGTTTTTCTGG + Intergenic
971050268 4:22854293-22854315 CTTTTTGTGATAAATTTCTCAGG + Intergenic
971988708 4:33863860-33863882 TTTTTTTTGATGCTTTTGTCTGG - Intergenic
972269322 4:37494887-37494909 CTTTTTTTCATATGTTTGTTGGG + Intronic
973149661 4:46871711-46871733 CTTTTTTTCATATGGTTGTTTGG - Intronic
974557347 4:63467983-63468005 ATATTTTTGACACGTTTGCCTGG - Intergenic
974860092 4:67509991-67510013 CTTTTTTTGGTTTGTTTGTTTGG - Intronic
976877140 4:89866909-89866931 CTTTTTTTCATATGTTTGTTGGG + Intergenic
977183719 4:93910060-93910082 GTTTTTTTCATATGTTTGTTGGG + Intergenic
977347780 4:95839782-95839804 TTCTATTTGATACGCTTGTCGGG + Intergenic
977467251 4:97398144-97398166 CTTTTATTCATATGTTTGTTGGG + Intronic
977659643 4:99568255-99568277 CTTTTTTTGGTATGTTTTTGGGG - Intronic
978614364 4:110579262-110579284 CTATTTTAGATAGGGTTGTCAGG + Intergenic
979147371 4:117261875-117261897 CTTTCTTGGATCCCTTTGTCAGG - Intergenic
979489789 4:121312374-121312396 TTTTTTGTGATATTTTTGTCTGG - Intergenic
979650795 4:123128406-123128428 CTTTTTCTGATACTTGAGTCAGG + Intronic
980186914 4:129474092-129474114 CTTTTTTTGATGAATTTCTCAGG + Intergenic
981795161 4:148587502-148587524 CATTTTTTCATATGTTTGTTAGG + Intergenic
981887124 4:149689808-149689830 CATTTTTTCATATGTTTGTTGGG - Intergenic
981895968 4:149800026-149800048 CCTTTTTTGGTATCTTTGTCTGG - Intergenic
982080660 4:151786578-151786600 CTTATTTTGATGCCATTGTCAGG + Intergenic
983380490 4:166985883-166985905 CTTTATCTGTTACGTTTGTTTGG - Intronic
984465753 4:180099121-180099143 CTTTTTTTGTTATCTTTGCCAGG + Intergenic
987816796 5:22912467-22912489 CTTTTTTTGACCGGTTTGTTGGG - Intergenic
988325121 5:29754869-29754891 CTTTTTTTCATAGGTTTTTTTGG + Intergenic
988953454 5:36289766-36289788 CATTTTTTGATAGATTTCTCAGG + Intronic
989060942 5:37411022-37411044 CTTTTTCTGATTCATTTGCCAGG - Intronic
989603864 5:43225326-43225348 CTTATTTTGATACCTCTCTCTGG + Intronic
990712679 5:58603302-58603324 CTTTTTGTGATACATTTCCCAGG + Intronic
990871950 5:60441818-60441840 TTTTTTTTCATACGTTTGCAGGG - Intronic
991078248 5:62566390-62566412 TTTTTTTTCATATGTTTGTTGGG + Intronic
991096337 5:62743894-62743916 CATTTGTTGATATGATTGTCTGG - Intergenic
991380918 5:66025350-66025372 CTCTTTTAGATACGTTTGTTAGG + Intronic
991553415 5:67868446-67868468 CTTTTTTTGTTATGTCTGTCAGG + Intergenic
992577697 5:78134994-78135016 CTTTCTTTGATATGTTTTCCTGG - Intronic
993006896 5:82438266-82438288 CTTTCTTTGATACGATTCACTGG + Intergenic
993286612 5:86007358-86007380 TTTTTTTTCATATGTTTGTTGGG + Intergenic
993317656 5:86431412-86431434 CTTTTTTTGAGACATTTATTTGG - Intergenic
993820569 5:92610473-92610495 CTTTTTTTCATGTGTTTGTTAGG - Intergenic
994869515 5:105328694-105328716 CTTCATTTGGTAAGTTTGTCCGG + Intergenic
995304500 5:110629658-110629680 TTTTTTCTGATACTTTTATCTGG + Intronic
995572810 5:113498907-113498929 CCTTTTTTGATGTCTTTGTCTGG + Intergenic
996247975 5:121288388-121288410 TTTTTTTTCATACGATTGTTTGG + Intergenic
996462700 5:123765220-123765242 CTTTTTTTCATATGTTTGTTGGG + Intergenic
996565775 5:124878856-124878878 CTTTCCTTGATACATTTGTCTGG + Intergenic
996872838 5:128210948-128210970 CTTTTCTTTATACTTTTATCAGG - Intergenic
997217140 5:132122061-132122083 CTTTTTTTCGTATGTTTGTTGGG - Intergenic
998101115 5:139435612-139435634 CTTCTTATGATATTTTTGTCTGG + Intronic
1002499434 5:179638068-179638090 CTTTTTGTAATGCTTTTGTCAGG - Intergenic
1002766361 6:242516-242538 CTTTTTTTGATGTCTTTGTCTGG - Intergenic
1002863112 6:1097252-1097274 ATTATTTTGACACTTTTGTCCGG + Intergenic
1004447548 6:15714120-15714142 CTATTTTTGATAGGGTGGTCAGG + Intergenic
1005769994 6:29059387-29059409 CTTTTTTTCATATGTTTGTTGGG + Intergenic
1006503766 6:34475041-34475063 CTGTTTTTGATAAGGTGGTCTGG - Intronic
1006749919 6:36370521-36370543 CTTTTTTTGAGACGGGAGTCTGG - Intronic
1006943707 6:37770063-37770085 CAGCTTATGATACGTTTGTCTGG - Intergenic
1008655030 6:53603216-53603238 TTTTTTTTGCTACAATTGTCAGG + Intronic
1008890654 6:56485953-56485975 CATTCATTGATCCGTTTGTCAGG + Intronic
1010556520 6:77286930-77286952 CTTTTTTTGACATGTTTGTTGGG - Intergenic
1011319476 6:86074814-86074836 CTTTTTTTGATAGGTTATTGGGG + Intergenic
1011343529 6:86344425-86344447 CCTTTTTTGATGTCTTTGTCTGG - Intergenic
1011404527 6:87004276-87004298 CTATTTTTGATATCTTTGTCTGG - Intronic
1012286837 6:97400788-97400810 CTTTTTTTGTTATTTTTGTTTGG - Intergenic
1012870640 6:104669255-104669277 CTTTTTTTCATATGTTTGTTAGG - Intergenic
1013383942 6:109605488-109605510 CTTTTTTGGAGAAGTTTGTGTGG + Intronic
1014344924 6:120256476-120256498 TTTTTTTTGATACAATTGTCTGG - Intergenic
1014361534 6:120482429-120482451 CATTTTTTGCTACGTTTTTGAGG + Intergenic
1015268505 6:131314527-131314549 CATTTTTTGATAGGATTGTTTGG + Intergenic
1016203516 6:141443168-141443190 CTCTTTTTGATAGGCTTATCAGG + Intergenic
1016675841 6:146766769-146766791 CTTTTTGTGTTACCTTTATCTGG - Intronic
1016784072 6:147990717-147990739 CTTTTTTTCATATGTTTCTTGGG - Intergenic
1016874768 6:148853723-148853745 CTTTTTTTCATATGTTTGGTTGG + Intronic
1017287518 6:152693490-152693512 TTTTTTGTGGTAGGTTTGTCTGG - Intergenic
1017288232 6:152703038-152703060 CTTTCTCTGATAGCTTTGTCAGG + Intronic
1017365096 6:153626466-153626488 CTTTCTGTGATACATTTGTAGGG - Intergenic
1017372769 6:153732890-153732912 CTTTTTTTCACATGTTTGTTGGG - Intergenic
1017728371 6:157292186-157292208 ATTTTTTTGAGAAGTTGGTCTGG - Exonic
1019675278 7:2307867-2307889 CTTTTTGTGATGCTTTTCTCAGG + Intronic
1020609796 7:10380932-10380954 CTTTTTTTAATGTGTCTGTCTGG - Intergenic
1020848131 7:13313256-13313278 TTTTTTGTGATATTTTTGTCTGG + Intergenic
1021382770 7:19988338-19988360 TTTTTTGTGATGCCTTTGTCTGG + Intergenic
1021479402 7:21099498-21099520 CTTTCTTTAATAAGTCTGTCAGG - Intergenic
1021776894 7:24063097-24063119 CTTTTTCTCATATGTTTGTTGGG - Intergenic
1022002258 7:26237094-26237116 CATTTTCTGTTATGTTTGTCTGG - Intergenic
1025772929 7:64529800-64529822 CTTTTTGTGATAAATTTCTCAGG - Intronic
1027828206 7:83143613-83143635 CATATTTTAATATGTTTGTCAGG + Intronic
1029054518 7:97727375-97727397 ATTTTTTTTTTACTTTTGTCCGG + Intergenic
1029887097 7:103884662-103884684 CTTTTTTTCATATTTTTGTTGGG - Intronic
1030013411 7:105194250-105194272 TTTTTTTAGATACCTTTATCAGG - Intronic
1032816638 7:135482601-135482623 TTTTTTGTGATATCTTTGTCTGG - Intronic
1034012808 7:147548367-147548389 CTTTTTTTCATATGTTTGTTGGG + Intronic
1034719414 7:153275599-153275621 CTGTTTTTCATAGATTTGTCTGG + Intergenic
1034742489 7:153490275-153490297 ATTTTCTTGAGATGTTTGTCTGG - Intergenic
1035235129 7:157492490-157492512 CTTTTTTTGTGACCTTTGTGGGG + Intergenic
1038596284 8:28889795-28889817 CTTTTTTTCCTACGTTGGGCAGG - Intronic
1039297362 8:36170790-36170812 TTTTTTTTGGTACATTTGTTGGG + Intergenic
1042637142 8:70890183-70890205 CATTTTTTCATATGTTTGTTGGG + Intergenic
1042686025 8:71441419-71441441 GTTTTTTTGGTTTGTTTGTCTGG - Intronic
1043041757 8:75272718-75272740 CATTTTTTCATATGTTTGTTGGG - Intergenic
1043876281 8:85490457-85490479 CTTTTTGTGATACATTTCCCAGG + Intergenic
1046253855 8:111670389-111670411 CTTTGTTTAATATGCTTGTCTGG + Intergenic
1050133465 9:2438019-2438041 CTTTTTGTGATAAATTTCTCGGG + Intergenic
1050929886 9:11309585-11309607 CTTTTTTTGACATGTCTGTCTGG + Intergenic
1051324781 9:15953639-15953661 TTTCTTGTGATACATTTGTCTGG + Intronic
1051611136 9:18962408-18962430 CTTTTTTTCATATGTTTGTTTGG + Intronic
1052302467 9:26968802-26968824 CTTTTTTTCATTAGTTAGTCTGG + Intronic
1055306966 9:74939779-74939801 CTTCTTGTAATATGTTTGTCTGG + Intergenic
1062256864 9:135628549-135628571 TTTCTTGTGATACCTTTGTCTGG + Intronic
1203626242 Un_KI270750v1:27077-27099 TTTTTTTTGATGCTATTGTCTGG - Intergenic
1185819641 X:3189683-3189705 GTTTTTATGATAGGTTTATCAGG + Intergenic
1186755166 X:12663032-12663054 CATTTTTTGATAGGGTTGTTTGG + Intronic
1187237315 X:17479657-17479679 CTTTTTTTCATATGTTTGTTGGG + Intronic
1187791401 X:22954132-22954154 CTTTTTGTGCCACCTTTGTCAGG - Intergenic
1188853894 X:35168015-35168037 CTTTTTTTGATATGTCTGTCTGG + Intergenic
1189878136 X:45458228-45458250 CATTTTTTCATATGTTTGTTGGG + Intergenic
1189949816 X:46217139-46217161 TTGTTTTTGATAACTTTGTCTGG + Intergenic
1191058293 X:56267001-56267023 CTTTTTTTGGTTTGTTTGTTTGG - Intronic
1192662586 X:73057720-73057742 CTTTTTCTCATATGTTTGTTGGG - Intergenic
1192720825 X:73696010-73696032 CTTTTTATCATATGTTTGTTGGG - Intergenic
1192951012 X:76016003-76016025 CTTTTTTTGATGAATTTGTCTGG - Intergenic
1193005627 X:76615782-76615804 ATTTTTTTGATATGTTTGTTGGG - Intergenic
1193093251 X:77517699-77517721 CTTTTTTTGATGTGTTTGTCTGG - Intronic
1193217398 X:78880261-78880283 CTTTTTTTCATATGTTTTTTGGG - Intergenic
1193265978 X:79470011-79470033 CATTTTTTCATAGGTTTGTTGGG - Intergenic
1193327533 X:80197287-80197309 TTTTTTTTGGTAAATTTGTCAGG + Intergenic
1193544734 X:82812649-82812671 CTTTTTTTCATATGTTTGTTGGG - Intergenic
1193817409 X:86120918-86120940 CTTTTTGTGATAAATTTCTCAGG + Intergenic
1194550258 X:95289574-95289596 CTTTTATTGTTACCTTTTTCTGG - Intergenic
1194942156 X:100023969-100023991 CTTTTTTTGTTGTGTCTGTCTGG - Intergenic
1195169247 X:102249821-102249843 CCTTTTTTGGTACCTTTTTCTGG + Intergenic
1195189610 X:102437267-102437289 CCTTTTTTGGTACCTTTTTCTGG - Intronic
1195424788 X:104716651-104716673 CTTTTTTTCATATGCTTGTTGGG - Intronic
1195999288 X:110764012-110764034 CATTTTTTCATATGTTTGTTGGG + Intronic
1196279420 X:113805452-113805474 CTTTTTTTGTTATTTTAGTCAGG + Intergenic
1197099259 X:122632823-122632845 TTTTTTTTGATGTGTCTGTCTGG + Intergenic
1198390886 X:136172649-136172671 CTATTTTTAAAACGTTTGTTTGG + Intronic
1198411677 X:136375647-136375669 CATTTTTTCATATGTTTGTTGGG + Intronic
1198757766 X:139998802-139998824 CTTTTTTTCATATGTTTGTTGGG + Intergenic
1199221311 X:145319226-145319248 CTTTTTTTGATGTGACTGTCTGG - Intergenic
1199563666 X:149191203-149191225 CTTTTTTTCATATGTTTATTGGG + Intergenic
1199668989 X:150126226-150126248 CATTTTTTCATACGTTTTTTTGG - Intergenic
1200608157 Y:5292207-5292229 CTTTTTTTGATACGTTTGTCTGG + Intronic
1200921661 Y:8618727-8618749 CTTTTTTTGTTTTGTTTTTCTGG + Intergenic