ID: 1200609864

View in Genome Browser
Species Human (GRCh38)
Location Y:5314599-5314621
Sequence ATGATCATCTTGAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 2, 1: 0, 2: 3, 3: 34, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200609864_1200609866 -2 Left 1200609864 Y:5314599-5314621 CCATTTTTCCTCAAGATGATCAT 0: 2
1: 0
2: 3
3: 34
4: 383
Right 1200609866 Y:5314620-5314642 ATCCTTATTTTATTTAATATTGG 0: 2
1: 3
2: 45
3: 268
4: 1018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200609864 Original CRISPR ATGATCATCTTGAGGAAAAA TGG (reversed) Intronic
901896720 1:12319869-12319891 TTGAACTTCTTGAGGAAGAAAGG - Intronic
901984388 1:13062823-13062845 TTGTTTATTTTGAGGAAAAAAGG - Intronic
901997422 1:13163947-13163969 TTGTTTATTTTGAGGAAAAAAGG + Intergenic
902721600 1:18307967-18307989 ATCGTCATCTTAAGGAGAAAAGG + Intronic
903287012 1:22283718-22283740 CACATCATCTTGAGCAAAAAAGG + Intergenic
905102222 1:35534308-35534330 AGAATGATCTTTAGGAAAAATGG - Intronic
906078935 1:43071022-43071044 ATGTTTGTCTTGAGGAATAAAGG + Intergenic
906791895 1:48666122-48666144 ATAATCATCTTTAGGCAAAATGG + Intronic
906863960 1:49395303-49395325 AGTATCAACTTGAAGAAAAAGGG + Intronic
907027211 1:51132186-51132208 ATGGTCATTTGGAGGAAAGAAGG - Intronic
907416761 1:54319699-54319721 ATGACCACCTGCAGGAAAAATGG + Intronic
908910797 1:69071025-69071047 ATGATCATTTGGAGGAGAAGAGG + Intergenic
910535749 1:88295652-88295674 ATGATCTGCTTCAGGAAAGAAGG - Intergenic
911541230 1:99161288-99161310 ATGATCCTTTGGAGGAAAAGAGG + Intergenic
911794628 1:102059716-102059738 ATGGTCATTTGGAGGAAAAGGGG - Intergenic
912071714 1:105818778-105818800 CTGATCATGTTGAGGAATTAGGG - Intergenic
912833919 1:112978581-112978603 ATGACTATCTGGAGAAAAAAAGG + Intergenic
912860030 1:113206115-113206137 ATGATGATGTAGTGGAAAAATGG - Intergenic
913442740 1:118916147-118916169 ATAAGCTCCTTGAGGAAAAATGG - Intronic
915037857 1:152943684-152943706 ATGATCTTCTTGGGGAAATAAGG - Intergenic
915630193 1:157147996-157148018 ATGGTCATCGTTATGAAAAAGGG + Intergenic
916258470 1:162815292-162815314 ATCATCAGATTCAGGAAAAATGG + Intergenic
916985823 1:170190872-170190894 GTGATCATTTGGAGGAAAATGGG + Intergenic
917196808 1:172475255-172475277 ATTGTCATGTTGAGGACAAATGG - Intergenic
917256257 1:173119825-173119847 ATAATTATCCTGAGGGAAAAAGG - Intergenic
917289941 1:173461527-173461549 GTGATCATTTGGAGGAAAAGGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918760988 1:188406827-188406849 AGGATTATCCTGAGGATAAAAGG - Intergenic
919003696 1:191868091-191868113 AAAATTATCTAGAGGAAAAATGG + Intergenic
919078693 1:192843855-192843877 ATGATCTAGTTGAGGAAATAAGG + Intergenic
919136704 1:193518348-193518370 AAGGTCATCTTGAGCAAAGAAGG + Intergenic
920608061 1:207409437-207409459 ACAATTATCTTGAGGCAAAAAGG + Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921476443 1:215616317-215616339 ATGATCATCTTGATAAATACAGG + Intronic
921656872 1:217749875-217749897 ATGCTCATATTGAGGAGCAAAGG - Intronic
921728754 1:218553356-218553378 CTGAACATCTGGAGGAAATATGG - Intergenic
922566439 1:226604566-226604588 ATGATCATCTTCAGTAGATAAGG + Exonic
923876534 1:238055253-238055275 AAAATTATCTAGAGGAAAAAAGG + Intergenic
924955008 1:248917662-248917684 ATGTCCATTTTGAGGAAAAAGGG + Exonic
1063599534 10:7467611-7467633 ATCATAATGTTGAGTAAAAAAGG - Intergenic
1063689390 10:8272008-8272030 ATGACCCTCTTCAGGCAAAAGGG + Intergenic
1064713313 10:18149064-18149086 ATGTTCCTCATGAGGATAAACGG + Intronic
1064848329 10:19681714-19681736 GTGATCATTTGGAGGAAAAGAGG + Intronic
1066724913 10:38380980-38381002 ATCATCAGATTCAGGAAAAATGG + Intergenic
1067099211 10:43322585-43322607 ATGATTACTTTGAGGAAGAAAGG + Intergenic
1067660120 10:48230601-48230623 GTGATTATCTTTAGTAAAAATGG + Intronic
1067986948 10:51159807-51159829 ATGGTCACATGGAGGAAAAAAGG + Intronic
1068893359 10:62171697-62171719 ATTATCTTCTTGACAAAAAAAGG + Intergenic
1069714767 10:70513738-70513760 ATGAGCATTTTGAGGACAACTGG - Intronic
1070571792 10:77645491-77645513 ATGATCATCTTTGGGAAGCAGGG - Intergenic
1070876556 10:79817866-79817888 ATCATCATGTTGAGTAAAATAGG - Intergenic
1073579299 10:104649574-104649596 ATGAGCATCTTGATGAGAACTGG - Intronic
1074611946 10:115030296-115030318 TTGATCATCTATAGTAAAAATGG + Intergenic
1077932368 11:6747037-6747059 TTGATCATCTTAATGAGAAATGG + Intergenic
1078570067 11:12450055-12450077 ATGATCAGTTTGAGTAAAATGGG - Intronic
1079012162 11:16837797-16837819 ATGATCTTCACCAGGAAAAAGGG + Intronic
1079315091 11:19400789-19400811 ATCATCATCTTGATGGAAAATGG + Intronic
1079723854 11:23854347-23854369 ATCATCATATTGTGGGAAAAAGG + Intergenic
1079783326 11:24637762-24637784 ATAAACATCTTCAGGAAACAGGG - Intronic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1081177593 11:39947533-39947555 GTGATCATTTGGAGGAAAGAGGG - Intergenic
1082188123 11:49208907-49208929 ATAATATTCTTTAGGAAAAAGGG - Intergenic
1083738753 11:64696635-64696657 ATGGACATCACGAGGAAAAATGG + Intronic
1085965394 11:81517140-81517162 AAGATAATGGTGAGGAAAAAAGG - Intergenic
1086046149 11:82534298-82534320 ATGACCATTTTGATTAAAAATGG - Intergenic
1086267490 11:85018832-85018854 TTGTTTATTTTGAGGAAAAAAGG + Intronic
1086463218 11:87026393-87026415 TTGTTTATTTTGAGGAAAAAAGG - Intergenic
1087585341 11:100112284-100112306 ATGAACATGTTGAGGAATAAGGG + Intronic
1088039354 11:105358245-105358267 ATGATCATTTTCTGGAAAGAAGG + Intergenic
1088084328 11:105959656-105959678 GTGATCATCTGGAGGAGAATAGG + Intronic
1088152039 11:106757406-106757428 TTGATCCTCTGGAGGAGAAAAGG + Intronic
1089701228 11:120245303-120245325 ATGATCAGGATGAGGAAAAAGGG - Intronic
1090116997 11:123984184-123984206 GTGATCATTTTGAGGAGAAGAGG + Intergenic
1090482185 11:127078479-127078501 ATCTTCATCGTCAGGAAAAAGGG + Intergenic
1090649938 11:128797810-128797832 GTGATCATCTTTAGGAAGAGGGG - Intronic
1090880209 11:130826249-130826271 ATGATCATTTAAAGGAGAAACGG + Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1092703376 12:11257435-11257457 ATGATCATTTGGAGGAGAAGAGG - Intergenic
1092972312 12:13708402-13708424 ATGATCTTCGTATGGAAAAAGGG - Intronic
1093133683 12:15422889-15422911 ATTATTATCTGGAGGAGAAATGG - Intronic
1095251533 12:39984737-39984759 ATGTCCGTCTTGATGAAAAATGG + Intronic
1095595433 12:43952225-43952247 GTGATCATTTGGAGGAAAAGAGG - Intronic
1095671006 12:44860027-44860049 ATTAACATTTTGAGGAGAAAGGG + Intronic
1096051651 12:48614983-48615005 GTGGTCATTTGGAGGAAAAAAGG + Intergenic
1097643000 12:62204881-62204903 ATGATCATTTGGAGGAGAAGAGG + Intronic
1098193478 12:67975791-67975813 AAGACCATCTTGCTGAAAAAAGG - Intergenic
1102639072 12:114350449-114350471 ATCTTCATCATGAGGAAAACTGG + Intergenic
1103278319 12:119732838-119732860 ATGAGCAAGTTGATGAAAAATGG + Intronic
1104465858 12:128989873-128989895 ATGAGGATCTTGGGGAAGAAAGG - Intergenic
1107593871 13:41940831-41940853 ATCATCATCTTGATGTACAAAGG + Intronic
1107972497 13:45657084-45657106 ATGATCATATATAGGTAAAATGG + Intergenic
1108467761 13:50734555-50734577 GTGATCATTTAGAGAAAAAAGGG + Intronic
1108764177 13:53606389-53606411 AGGATCCTTTTGAGGAAAGATGG - Intergenic
1108869372 13:54963785-54963807 ATGATAATCATGTGGAATAAAGG - Intergenic
1109147246 13:58794970-58794992 ATAATAATCGTGAGGAAATAAGG + Intergenic
1109756140 13:66762460-66762482 ATCATAAGCTTGAGGAAAGATGG - Intronic
1111733243 13:92103178-92103200 ATGATCAACCTGGGGGAAAAAGG + Intronic
1111786172 13:92789348-92789370 ATGTTTATCTTGAGCAAAACAGG + Intronic
1111869596 13:93813616-93813638 AAGAATATCTTGAGGAAAATGGG + Intronic
1112048174 13:95617936-95617958 ATGAGCATCTGGAGGAACGAGGG + Intronic
1114282864 14:21210582-21210604 TTGTTTATTTTGAGGAAAAAAGG + Exonic
1114895742 14:26988924-26988946 CTAATCATCTTGAGGGAGAAGGG - Intergenic
1114939176 14:27585325-27585347 ATGATCATTTTGAGACAAAGGGG - Intergenic
1115339716 14:32280177-32280199 ATTATCATCTTGAAGAAAAAAGG - Intergenic
1115859195 14:37665695-37665717 TTGAGCATCTTGAAGAAAAAGGG + Intronic
1116139513 14:40972993-40973015 ATAAAGATCTTTAGGAAAAATGG + Intergenic
1116564022 14:46421785-46421807 TTCACCATTTTGAGGAAAAAGGG + Intergenic
1117009651 14:51457540-51457562 AGGATCATCTGCAGGAAAAATGG - Intergenic
1117710400 14:58522605-58522627 TTGTTTATTTTGAGGAAAAAAGG - Intronic
1119276275 14:73359533-73359555 AGGAACATCTTGATGAAAAAGGG + Intronic
1120509598 14:85397358-85397380 ATGATCCTCTTGCTGAAAATAGG + Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1120637995 14:86974910-86974932 ATGGTCATTTGGAGGAAAAGCGG - Intergenic
1124971058 15:34490076-34490098 ATTATCATTTTCAGGAAGAATGG - Intergenic
1126470809 15:49008427-49008449 ATGAACAGCTTGAAGGAAAAAGG - Intronic
1126616915 15:50592314-50592336 AAGATCACCTTGAGGAAGAGAGG + Exonic
1126718306 15:51547325-51547347 AGGATCATCATGAAGTAAAAAGG - Exonic
1129526907 15:76224013-76224035 AATATTCTCTTGAGGAAAAAAGG + Intronic
1131590044 15:93739416-93739438 GTGGTCATTTTGAGGAAAGAAGG + Intergenic
1132416507 15:101623998-101624020 ATGATCACCTTGAGGAGGATGGG + Intronic
1133477261 16:6135479-6135501 ATCATCATTTTGAGGCAAATTGG + Intronic
1135106053 16:19650846-19650868 ATTATTATCTAGAGGAAAAAAGG - Intronic
1135802278 16:25508568-25508590 ATCATCATCTTATGCAAAAAGGG - Intergenic
1137424807 16:48369230-48369252 AGAATTATCTTCAGGAAAAATGG - Intronic
1141233303 16:82191568-82191590 ATCATCATCTTGTAAAAAAAAGG + Intergenic
1143770911 17:9168190-9168212 ATGATTATCTTGATGATAACTGG + Intronic
1149377827 17:56063804-56063826 GTGATCATTTAGAGGAGAAAAGG + Intergenic
1152992122 18:373122-373144 ATTTCCATCTTGATGAAAAATGG + Intronic
1153136687 18:1925587-1925609 ATCAAAAGCTTGAGGAAAAATGG - Intergenic
1153762276 18:8343001-8343023 ATGAGCCTCTATAGGAAAAATGG - Intronic
1153988687 18:10376101-10376123 ATGATATACTGGAGGAAAAAAGG - Intergenic
1155275094 18:24179472-24179494 ATGATCTACATAAGGAAAAAAGG + Intronic
1155591325 18:27430077-27430099 ATGATGATCTTAAGGAAACCTGG + Intergenic
1155837288 18:30601830-30601852 AGGATAAACTTGAGCAAAAAGGG + Intergenic
1155844913 18:30694468-30694490 ATGGTCATCTGGAGGAAAGAAGG + Intergenic
1155862661 18:30923112-30923134 AAAAACCTCTTGAGGAAAAAAGG + Intergenic
1155902810 18:31411771-31411793 ATGCTCATCAAGGGGAAAAAAGG + Intronic
1156434022 18:37106887-37106909 AGGAAAATCTTGAGGAGAAAAGG - Intronic
1156693754 18:39740781-39740803 ATGAACATTTTGATGGAAAATGG + Intergenic
1156699946 18:39814300-39814322 GTGATCATTTGGAGGAAAGAGGG + Intergenic
1156897998 18:42268744-42268766 AGTATCATCTAGAGGAAAGATGG + Intergenic
1158337311 18:56426809-56426831 GTGTTCATTTGGAGGAAAAAAGG - Intergenic
1158626276 18:59074317-59074339 AAGAACATCTGAAGGAAAAATGG - Intergenic
1159302346 18:66590938-66590960 ATTATCCTCTTGAGGAAGAAAGG - Intronic
1159992301 18:74923017-74923039 ATGATCATTTTTAGCATAAATGG + Intronic
1163667398 19:18609817-18609839 ATTATCTCCTTGAGGACAAAAGG + Intronic
1163872329 19:19832105-19832127 TTGATCATTTGGAGGAGAAAAGG - Intergenic
1164044223 19:21521464-21521486 ATGAGCATTATGAAGAAAAAGGG - Intronic
1164053409 19:21602458-21602480 AGGTTCATATTGAGGAGAAAAGG - Intergenic
1164897045 19:31886035-31886057 ATGATCATCTTGAGGGGTTAGGG - Intergenic
1167729722 19:51244829-51244851 AACATCATCTTGAGGCAAAGAGG - Intergenic
926159822 2:10479599-10479621 TTGGTCATCTTGAAGCAAAATGG - Intergenic
926847971 2:17162796-17162818 ATGATCATGTCTAGGAAGAATGG - Intergenic
928228925 2:29479090-29479112 CTGATCATCTTGGAGAGAAAGGG + Intronic
928489097 2:31762511-31762533 ATGATCAGCTTGAGAAAGATAGG - Intergenic
928569848 2:32594798-32594820 ATAATCATCTTTATGAAAAGAGG - Intronic
928867062 2:35929383-35929405 ATCATCTTCCTTAGGAAAAAAGG + Intergenic
929105641 2:38362920-38362942 ATGGACATCTGGAGGAAAAGAGG + Intronic
929362618 2:41112372-41112394 ATGATGATGTTGTGGAGAAAAGG - Intergenic
929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG + Intergenic
930420393 2:51145455-51145477 ATGCTCATATTGTGGAAAGAGGG + Intergenic
930924441 2:56799797-56799819 ATGATCATCATCAGAAAAAAAGG - Intergenic
932013592 2:68001566-68001588 ATGATCATTTGGAGGAGAAAAGG - Intergenic
933159934 2:79012284-79012306 TTTATCATCTTGGGGGAAAAAGG + Intergenic
933822427 2:86125846-86125868 ATGAGAAATTTGAGGAAAAATGG + Exonic
934013249 2:87849462-87849484 ATGATAATGTTTTGGAAAAAAGG - Intergenic
934874622 2:97905733-97905755 ATGAACATAATGAGGGAAAATGG - Intronic
935126218 2:100225255-100225277 ATGAACATCTTGATGTAATATGG - Intergenic
935465922 2:103398066-103398088 ATGATCTGCTTGAGGTAAAGTGG - Intergenic
936775240 2:115965071-115965093 GTGATCATTTGGAGGAGAAAAGG + Intergenic
937351680 2:121168685-121168707 ATGATCAGGTTGTGTAAAAAAGG - Intergenic
937818240 2:126276938-126276960 ATGATCATATTGAGGCTAAAAGG - Intergenic
938337366 2:130511597-130511619 ATGAGCATCAAGTGGAAAAACGG - Intergenic
938352472 2:130609138-130609160 ATGAGCATCAAGTGGAAAAACGG + Intergenic
939860492 2:147414645-147414667 AAGATCATCTTGCTGAAATAAGG - Intergenic
940806739 2:158195805-158195827 ATGATCAATTTGAAGAAAAGTGG - Intronic
940858131 2:158745615-158745637 TTGATCATCTTGATGACAATGGG - Intergenic
942262270 2:174180581-174180603 ATGACTGTCTTTAGGAAAAAAGG - Intronic
942875253 2:180787953-180787975 ATAATCATACTGAGTAAAAAAGG + Intergenic
943052172 2:182927794-182927816 AACATCAGCTTGGGGAAAAAAGG + Intronic
943095006 2:183417705-183417727 ATGATCATTTGGAGGAGAAGAGG - Intergenic
943148294 2:184074736-184074758 TAAATCATCATGAGGAAAAAAGG + Intergenic
943601371 2:189924839-189924861 TTGTTTATTTTGAGGAAAAAAGG - Intronic
943799336 2:192038292-192038314 ATGATGAACTTGAGGTACAAAGG - Intronic
944337628 2:198555818-198555840 ATGAAAACCTTGAGAAAAAATGG - Intronic
944510662 2:200462162-200462184 ATGATCCTCTTGAACCAAAATGG + Intronic
944630991 2:201624040-201624062 ATTATCATCTTAATGACAAAGGG - Exonic
945164436 2:206927485-206927507 GTGATCATTTGGAGGAAAAGAGG - Intergenic
945572920 2:211492867-211492889 TTGATCATCCTTAGGAAACAAGG - Intronic
945705645 2:213227850-213227872 ATGATGAAGTTGGGGAAAAATGG - Intergenic
945761648 2:213922575-213922597 ATGATTATTTAGAGGAAAGAAGG + Intronic
946242742 2:218367079-218367101 ATGCCCATCTTGAGGGAAGAGGG + Exonic
946672213 2:222117057-222117079 AAGCTCATCATAAGGAAAAAAGG + Intergenic
1169729569 20:8772205-8772227 ATTATCATCTGTAGGAAACAGGG - Intronic
1169731274 20:8787619-8787641 AGGTTCCTCATGAGGAAAAAAGG + Intronic
1170455372 20:16527985-16528007 ATGATCCTCTTCATTAAAAATGG + Intronic
1170709729 20:18779373-18779395 ATCATCATCTTGGGGAAAGAGGG - Intergenic
1170901848 20:20471232-20471254 ATGATCAGGTTTAGGGAAAATGG - Intronic
1172053107 20:32134388-32134410 ATGAATTGCTTGAGGAAAAATGG - Intronic
1173086515 20:39924473-39924495 TTGACCATTTTGAGGAATAATGG + Intergenic
1173091203 20:39974182-39974204 GTGATCATTTGGAGGAAAAGAGG + Intergenic
1175067449 20:56301552-56301574 ATGGTCATCTTTAGGCAAATCGG - Intergenic
1175743879 20:61439873-61439895 ATGGTGATATTGGGGAAAAAAGG + Intronic
1176344313 21:5727968-5727990 GTGATCATTTGGAGGAGAAAAGG + Intergenic
1176351127 21:5848552-5848574 GTGATCATTTGGAGGAGAAAAGG + Intergenic
1176500514 21:7596488-7596510 GTGATCATTTGGAGGAGAAAAGG - Intergenic
1176538634 21:8126037-8126059 GTGATCATTTGGAGGAGAAAAGG + Intergenic
1178181503 21:30167155-30167177 ATTACCATCTTAAGGAAAAGTGG - Intergenic
1179067637 21:38041123-38041145 TTCATCCTCTTGAAGAAAAATGG - Intronic
1182375788 22:29846849-29846871 ATGATCAGCTTGAGAAACATTGG + Intergenic
1203243580 22_KI270733v1_random:42392-42414 GTGATCATTTGGAGGAGAAAAGG + Intergenic
949250307 3:1975756-1975778 GTGATCATTTGGAGGAAAAGAGG - Intergenic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
951149626 3:19273436-19273458 ATGATCCTCTGGAGAAAAGAAGG - Intronic
951307277 3:21080726-21080748 AACATCTTTTTGAGGAAAAAGGG - Intergenic
952095936 3:29954121-29954143 ATGAGAATCTTGAGGCAAGAAGG - Intronic
952515521 3:34100558-34100580 ATGATCATCTTGATGGTAGAGGG + Intergenic
953717448 3:45328086-45328108 ATGTTTATCTTCATGAAAAAGGG - Intergenic
955444108 3:58990569-58990591 AAGATCTACTTTAGGAAAAATGG - Intronic
956371938 3:68572018-68572040 ATCATCATTTGGAGGAAAGAAGG - Intergenic
956526781 3:70172704-70172726 ATGAGCATCTAGAGAAAATATGG - Intergenic
957434716 3:80159962-80159984 ATAAATATCTTAAGGAAAAAGGG - Intergenic
957584217 3:82113930-82113952 GTGATCATTTGGAGGAGAAAAGG + Intergenic
958640603 3:96800326-96800348 ACGATCATTTGGAGGAAAAGAGG + Intergenic
958658083 3:97028891-97028913 ATGTTCATCTTCAAGCAAAAAGG - Intronic
959815130 3:110665897-110665919 ATGATCATTTAGAGAAAACAAGG - Intergenic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
962613503 3:137101749-137101771 ATTATCAACTCAAGGAAAAATGG - Intergenic
962863481 3:139426193-139426215 CTCACCATCTGGAGGAAAAAGGG - Intergenic
964207307 3:154188799-154188821 ATGAAGATGTGGAGGAAAAAGGG - Intronic
965075946 3:163976233-163976255 ATGAGCATATAGAGGATAAATGG + Intergenic
965217961 3:165888680-165888702 ATGATCATCTTGATGATAGAGGG - Intergenic
966080303 3:175992074-175992096 ATGATCTGCTTCAGGGAAAAAGG + Intergenic
966308454 3:178564616-178564638 ATATTAATCTTGAGAAAAAAAGG + Intronic
967197194 3:187038749-187038771 TTGATCATCCTGAGAAAAATGGG + Exonic
967348090 3:188480999-188481021 ATTATCATGTTTAAGAAAAATGG - Intronic
970101311 4:12525231-12525253 ATGGTCATTTGGAGGAAAGAAGG - Intergenic
970185217 4:13445110-13445132 AAGACCATCTTGTGGAAATAAGG - Intronic
970412177 4:15818943-15818965 AAGATCATCTGGAGGAGAAGAGG - Intronic
970553100 4:17203962-17203984 ATGATCATCCTGGGAATAAATGG - Intergenic
971133628 4:23841043-23841065 ATGATCATCTTTTGTAAAAGAGG + Intronic
971516758 4:27496897-27496919 ATAATCATCTGGAGGAGAAGAGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973248263 4:48034029-48034051 ATCATAATCTTGAGGACAGATGG + Intronic
973312543 4:48725040-48725062 TTAATCATCTTGAGGGATAATGG - Intronic
973545010 4:51972782-51972804 GTGATCATTTGGAGGAGAAAAGG + Intergenic
973837604 4:54825788-54825810 GTGATCCTTTTGAGGAGAAAAGG - Intergenic
974226100 4:59047226-59047248 TTTATCATTTTGATGAAAAAGGG + Intergenic
974306979 4:60155456-60155478 ATGATCCTTTTGAGGAGAAAAGG + Intergenic
974741491 4:66013560-66013582 ATGATCATTTGGAGGAGAAGAGG + Intergenic
974905372 4:68048608-68048630 TTGATAATCTTTAGGAAAAGTGG - Intergenic
975426989 4:74241366-74241388 ATAATGATATTGGGGAAAAATGG - Intronic
975435847 4:74350363-74350385 ATAATGCTGTTGAGGAAAAAGGG - Intergenic
975483452 4:74907616-74907638 ATTATTATCTGGAGGCAAAAAGG + Intergenic
975656295 4:76644204-76644226 ATGATCACCTTTTGGAAAAAAGG - Intronic
975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG + Intronic
976045022 4:80936146-80936168 ATGATGAGCTTGTGGAGAAATGG + Intronic
976225572 4:82793375-82793397 ATGATCTTTTGGAGGAAAACAGG + Intronic
976807299 4:89062827-89062849 GTGATCATCTGGAGGAGAAGAGG + Intronic
977696632 4:99972682-99972704 GTGATCATTTGGAGGAAAGAAGG - Intergenic
979153911 4:117357917-117357939 ATGATCATATTTAGGGAAGAAGG + Intergenic
979910111 4:126354426-126354448 GTCATCATGTTGAGAAAAAAGGG - Intergenic
980060308 4:128121223-128121245 ATTATCATTGTGAGGTAAAAAGG + Intronic
980276008 4:130651461-130651483 GTGATCATTTGGAGGAAAAGAGG - Intergenic
980721490 4:136701939-136701961 GTGATCAGATTGAGAAAAAAAGG - Intergenic
981133865 4:141188934-141188956 ATGATCCTTTGGAGGAAAAGAGG + Intronic
981355432 4:143784471-143784493 ATGATCATATATAGGAACAAAGG + Intergenic
982791123 4:159592643-159592665 ATGATCTGCTTCAGGGAAAAAGG + Intergenic
982848295 4:160277962-160277984 AAGATCATCTTGTTGAAATAAGG + Intergenic
983001976 4:162426392-162426414 ATGGTAATCTTGAGGAGACATGG + Intergenic
983420079 4:167506295-167506317 ATGGTCATTTGGAGGCAAAAAGG + Intergenic
983426660 4:167592914-167592936 ATGATCATCTTGGTGATAATGGG - Intergenic
984592769 4:181635404-181635426 ATGATCAAGTTGATGAAAAGAGG + Intergenic
984666434 4:182434255-182434277 GTGATAACCTTGAGAAAAAAAGG + Intronic
985391316 4:189493431-189493453 ATGGCCCTTTTGAGGAAAAATGG + Intergenic
986157231 5:5188513-5188535 ATGATTAGCTTGGGGAAAAATGG - Intronic
986274558 5:6262376-6262398 ATCATAATCTTGAGTAAAGAGGG + Intergenic
986514956 5:8551531-8551553 ATGATCATCTTCATGCACAAGGG - Intergenic
987125448 5:14807878-14807900 AAGATCAATTTCAGGAAAAAAGG + Intronic
988171939 5:27669448-27669470 ATGATCATCTTCTCAAAAAATGG - Intergenic
988668503 5:33356353-33356375 ATAATTTACTTGAGGAAAAAAGG + Intergenic
988683690 5:33507220-33507242 CCGGTCATCTTTAGGAAAAAAGG + Intergenic
991026542 5:62036719-62036741 GTGATCATTTGGAGGAGAAAAGG + Intergenic
991349190 5:65703143-65703165 ATGATAATATTGAAAAAAAATGG + Intronic
991443924 5:66680032-66680054 ATGAGCAGCTTGAAGAAAAAAGG + Intronic
992975700 5:82117097-82117119 ATGTTCTTATTGAGGATAAAAGG + Intronic
993265603 5:85722393-85722415 ATGATCCTTTGGAGGAAAAGAGG - Intergenic
993365420 5:87029504-87029526 GTGATCATTTGGAGGAAAAGAGG + Intergenic
993712322 5:91238146-91238168 ATGATTATCTTTAATAAAAATGG - Intergenic
994076781 5:95660601-95660623 ATGATCATATTTTGGATAAATGG - Intronic
994344642 5:98669692-98669714 GTGATCATTTGGAGGAGAAAAGG - Intergenic
994358991 5:98828494-98828516 ATGATCATTTACAGGAAAGAAGG - Intergenic
994843046 5:104951096-104951118 GTGATCATTTAGAGGAAAAGAGG + Intergenic
995138111 5:108702325-108702347 ATGAACATCTTTAGGAACAACGG + Intergenic
995329615 5:110932853-110932875 GTGGTCATTTTGAGGAAAAGGGG + Intergenic
996499499 5:124201559-124201581 AGGAACATCTTGTGGAAAAGAGG - Intergenic
996592390 5:125161778-125161800 GTGATCATTTGGAGGAGAAAAGG - Intergenic
997031077 5:130129095-130129117 CTGATTATCTTGAGGAAACTTGG - Intronic
997154324 5:131536921-131536943 ATGGTCATCTTTATGAACAAGGG - Intronic
997667197 5:135640748-135640770 ATGATCATCTTGATAAATACAGG + Intergenic
999549277 5:152667068-152667090 ATTATAATGTTGAGAAAAAATGG - Intergenic
1000497093 5:161997936-161997958 ATGCTTATCTTGGGGAAAATGGG + Intergenic
1000611148 5:163376291-163376313 ATAATCAGCTTAAGTAAAAAAGG - Intergenic
1000702098 5:164465228-164465250 ATGAGCAACTTGATGAAAATGGG + Intergenic
1000719994 5:164694026-164694048 GTGATCATCTGGAGGAGAAGCGG - Intergenic
1001294529 5:170489684-170489706 ATGAACAATTTGAGAAAAAATGG + Intronic
1001355299 5:171016439-171016461 ATAATCATATTAAAGAAAAATGG - Intronic
1002151518 5:177236570-177236592 ATGATCATGATCATGAAAAAAGG - Intronic
1002360010 5:178662812-178662834 ATGAGCATCTCGGAGAAAAAAGG + Intergenic
1002361596 5:178675880-178675902 ATGATCATCTTAATAAAAACAGG - Intergenic
1002860130 6:1072772-1072794 TTGATCATTTTGTGGAAAATGGG + Intergenic
1003228297 6:4226032-4226054 GTGATCCTTTGGAGGAAAAAAGG - Intergenic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1006634138 6:35450293-35450315 AGGATCAACTTGAGGAAAATTGG + Intergenic
1007105984 6:39283215-39283237 ATGGTCCTCCTGAGGAAATAAGG - Intergenic
1008082766 6:47210832-47210854 ATGATCATTTGGAGGAGAAGAGG - Intergenic
1008298590 6:49806580-49806602 GTGATCATCTGGAGGAGAAGAGG - Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008723103 6:54381940-54381962 ATGATCAGGTTGAGGATGAAAGG - Intronic
1012346609 6:98195401-98195423 ATGAGGAACTTGAGGAAAATTGG + Intergenic
1013415462 6:109920733-109920755 ATGATGATCTTGGAGAAACAAGG - Intergenic
1013996855 6:116319118-116319140 ATGAACATCTTGAAAATAAATGG - Intronic
1014548365 6:122758626-122758648 AGGATTATCTTCAGGAACAATGG - Intergenic
1015414039 6:132928539-132928561 ATAATCATTTTCAGGAAAACAGG - Intergenic
1015587487 6:134790316-134790338 ATGATCATTTGGAGGAGAAAAGG - Intergenic
1016613119 6:146015955-146015977 GTGACCATCTTAAGGAAATAGGG - Intergenic
1017251216 6:152281948-152281970 ATGATCAGCTGGAGGAACAAAGG - Exonic
1017484837 6:154892855-154892877 ATTATTATCTGGTGGAAAAAAGG + Intronic
1017990874 6:159488874-159488896 ATGATAAGCTTCAGGAAAAGGGG - Intergenic
1018567637 6:165172319-165172341 GTGAAGATCTTCAGGAAAAATGG - Intergenic
1018715506 6:166529732-166529754 ATCATCATCTTGTAGAAACAAGG - Intronic
1019113409 6:169737372-169737394 GTGATCATGTGGAGGAAAAGAGG + Intergenic
1020774785 7:12439425-12439447 ATGATCATAATAAGCAAAAATGG - Intergenic
1021031700 7:15745303-15745325 ATGATCATATTGACAAATAAGGG - Intergenic
1021425757 7:20497047-20497069 ATGGTCATTTGGAGGAAAGAAGG - Intergenic
1022574671 7:31486178-31486200 GTGATCATCTGGAGGACAGAAGG - Intergenic
1023172293 7:37401374-37401396 ATGATCTGCTTTAGGAGAAAAGG - Intronic
1023472487 7:40539322-40539344 TTTATCATCTTGAGTAAAGAAGG - Intronic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1024012112 7:45277247-45277269 ATGATCATGTTAAGTATAAATGG - Intergenic
1024319030 7:48046867-48046889 ATGCTTATCTAGAGGAAAACTGG + Intronic
1024831312 7:53461916-53461938 AATATCATTTAGAGGAAAAAAGG + Intergenic
1027507222 7:79032103-79032125 TGAATCATCATGAGGAAAAATGG + Intronic
1027776383 7:82470530-82470552 ATAATAATGTTAAGGAAAAAAGG + Intergenic
1029854107 7:103495930-103495952 ATTATTCTCTTGAGGAAAATTGG + Intronic
1030441134 7:109591365-109591387 ATTCTCATCCTAAGGAAAAATGG - Intergenic
1030442077 7:109598314-109598336 ATTCTCATCCTAAGGAAAAATGG - Intergenic
1031683726 7:124707171-124707193 ATAATCATCTTGAATATAAATGG - Intergenic
1032023507 7:128423151-128423173 ATGACAATCTTCAGAAAAAAGGG - Intergenic
1032705126 7:134414777-134414799 ATGATCGTCTTGGGGAAAAAAGG + Intergenic
1035109896 7:156472366-156472388 ATGATGATCTTTTGGAAACAGGG - Intergenic
1035834045 8:2728922-2728944 ATGATCATCTAAAGAAAAATGGG + Intergenic
1037747152 8:21654968-21654990 AAGATCCTCTTGAGGAACTAGGG + Intergenic
1039876946 8:41594930-41594952 GTTATCATCTTCAGAAAAAAAGG - Intronic
1042308613 8:67357996-67358018 ATGATCCTTTGGAGGAAAAGAGG + Intergenic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1044189605 8:89299446-89299468 ATGCTTATATTGGGGAAAAAGGG + Intergenic
1044324211 8:90841741-90841763 AGAATCCTCTTGATGAAAAATGG + Intronic
1044452809 8:92357992-92358014 ATCATCATCTTGGTGACAAAGGG - Intergenic
1045511634 8:102816213-102816235 ATGAAGATGTTGAGGAAAAAAGG + Intergenic
1045705323 8:104916067-104916089 GTGATCATCTGGAGGAGAAGAGG + Intronic
1045921378 8:107534089-107534111 ATGATGATCTAGAGAACAAATGG - Intergenic
1046403098 8:113733371-113733393 ATGATACTCTTTAAGAAAAATGG - Intergenic
1046643348 8:116757332-116757354 ATGATCACCTTGACAAGAAAGGG + Intronic
1048828298 8:138451254-138451276 TTGATCATCTTAAACAAAAAGGG - Intronic
1050106516 9:2171840-2171862 ATGACCATCTTGATGGAAGAGGG - Intronic
1050202309 9:3158435-3158457 TTGGTTATCTTGAGGAAAAGTGG - Intergenic
1050706504 9:8404767-8404789 AGGATCATCTTGATGAAGTATGG - Intronic
1051433035 9:16999773-16999795 AGGATCATATTGAGAATAAATGG - Intergenic
1051547153 9:18289665-18289687 ATGATCATGTTGAGGAGGAAAGG + Intergenic
1051924927 9:22312974-22312996 ATAATCATTTTTAGAAAAAATGG - Intergenic
1052206218 9:25844268-25844290 CTCATTATCTTGAAGAAAAAGGG + Intergenic
1052327837 9:27235036-27235058 AAAATCATCTTAAGGAAAAAAGG + Intergenic
1052639397 9:31145867-31145889 ATGGTCAACATGAGGCAAAAAGG - Intergenic
1053516040 9:38731729-38731751 ATGATCATCTCTAGGAGAATGGG + Intergenic
1053927146 9:43073884-43073906 ATCATCATCTAGTGGTAAAAAGG - Intergenic
1055003185 9:71476921-71476943 ATGATAATATTGTTGAAAAAGGG - Intergenic
1055188126 9:73481453-73481475 ATGATCACCTTGAAGAAAAAAGG - Intergenic
1055297669 9:74850868-74850890 CTGATCATCTTTTGGAACAAGGG + Intronic
1055796269 9:79977831-79977853 ATTAGCATCATGAGGGAAAAGGG + Intergenic
1056748855 9:89330039-89330061 ATTATGATGTTGATGAAAAAAGG + Intronic
1057522404 9:95770636-95770658 ATGTTTATCTGGAGTAAAAAGGG - Intergenic
1057939725 9:99271454-99271476 AGGATTATCTTTAGGAAGAAGGG - Intergenic
1059136063 9:111807598-111807620 ATGATCATTTGGAGGAGAAGAGG + Intergenic
1059746093 9:117203391-117203413 GTGATCATGTTGAGGAGAAGAGG + Intronic
1060320993 9:122561393-122561415 GTGATCATTTGGAGGAGAAAAGG + Intergenic
1187172478 X:16865500-16865522 ATGATCAAGTTGGGGAAAACTGG - Intronic
1187828015 X:23352399-23352421 TTGCTCATCTTGAGATAAAAGGG - Intronic
1188752039 X:33916635-33916657 ATGATCATCTTTGGTAGAAATGG + Intergenic
1188851935 X:35142874-35142896 CTGATCATCATGAGGAAGTAAGG - Intergenic
1189940031 X:46112204-46112226 GCGATCATTTGGAGGAAAAAAGG + Intergenic
1190506292 X:51129647-51129669 GAGATCATTTGGAGGAAAAACGG + Intergenic
1191198015 X:57745208-57745230 GTGATCATTTGGAGGAAAAGAGG - Intergenic
1191201794 X:57791128-57791150 ATGAGAATCTTGAAGTAAAAAGG - Intergenic
1192659261 X:73024605-73024627 ATAATTATCTTGAGTAAAAATGG - Intergenic
1192716581 X:73648625-73648647 AAGACCATCTTGCTGAAAAAGGG + Intronic
1192722391 X:73712764-73712786 ATAATCAGCCGGAGGAAAAAAGG - Intergenic
1193079496 X:77391619-77391641 AAGATCAGCTTGATGAAATAAGG + Intergenic
1193234258 X:79087140-79087162 AGGATCATTTTGAGGATAAAGGG - Intergenic
1193404881 X:81088578-81088600 AAGATCAGCTTAAGAAAAAAAGG + Intergenic
1193580887 X:83261003-83261025 ATGGTCATTTGGAGGAAAAAAGG - Intergenic
1193823670 X:86196030-86196052 ATGGTCATTTGGAGGAAAGAAGG - Intronic
1193882875 X:86946508-86946530 ATGCTCAGCTAGAGAAAAAAAGG + Intergenic
1194222454 X:91211829-91211851 ATGATTATCTGAAGAAAAAAAGG + Intergenic
1194292356 X:92089973-92089995 ATGATCATCTTGAGGAAAAATGG - Intronic
1194344751 X:92750220-92750242 ATGATCATTTGGAGGAAAGAAGG + Intergenic
1195827479 X:109018022-109018044 GTGATGGTCTTAAGGAAAAAGGG - Intergenic
1195932208 X:110089827-110089849 ATGACCCTCCTGAGTAAAAATGG + Intronic
1197048108 X:122025110-122025132 ATGATTCTCTTAAGTAAAAATGG + Intergenic
1197715035 X:129700509-129700531 ATGGTCACCTTTGGGAAAAAGGG + Intergenic
1197849003 X:130836919-130836941 ATGCTCACCTAGAGGATAAAAGG - Intronic
1197901254 X:131375325-131375347 ATGAACTTCTTCTGGAAAAATGG + Intronic
1199064202 X:143394942-143394964 ATGAACATCATTAGGAATAAAGG - Intergenic
1199100577 X:143794810-143794832 ATGATGATGCTGAGGCAAAATGG + Intergenic
1199131222 X:144189007-144189029 ATGATAATGTTTTGGAAAAAAGG + Intergenic
1199354650 X:146847909-146847931 ATGATGACCTTGAGGATAGAAGG + Intergenic
1200137974 X:153884087-153884109 ATGATTATCTGAAGGGAAAAGGG - Intronic
1200609864 Y:5314599-5314621 ATGATCATCTTGAGGAAAAATGG - Intronic
1200653096 Y:5866860-5866882 ATGATCATTTGGAGGAAAGAAGG + Intergenic
1201051125 Y:9936625-9936647 ATGATCATCTTGGGCAACACAGG - Intergenic
1201687598 Y:16724531-16724553 ATGATAATGTTTAGAAAAAAAGG - Intergenic