ID: 1200615137

View in Genome Browser
Species Human (GRCh38)
Location Y:5369666-5369688
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902076601 1:13791704-13791726 AATTTAATGTAGAGTGATGATGG - Intronic
902516116 1:16990421-16990443 AAACTGAGGCAAAGGGATGTTGG - Intronic
904191085 1:28744275-28744297 AAAGAGATGCAGAGGGGTAATGG + Intronic
905261742 1:36723870-36723892 CAGTTGATGCAAAGGGCTGAAGG + Intergenic
905918084 1:41699661-41699683 GAAAGGATGCAGAGGGATGCTGG + Intronic
906860280 1:49352040-49352062 CATTTGATGCAGAGGTATGCAGG - Intronic
907482048 1:54751853-54751875 AAATTGATGAAATGGGATGCTGG - Intergenic
908631953 1:66119034-66119056 AAATTCATCCAGAGAGATGAAGG + Intronic
912118807 1:106442379-106442401 AAATTGAAGATCAGGGATGAGGG + Intergenic
915298508 1:154938699-154938721 AAGCGGATGCTGAGGGATGAGGG - Intergenic
917294914 1:173508558-173508580 AAATTTTAGCAGAGGGATAAGGG - Intronic
917352453 1:174092235-174092257 AAACTGATGCAGGAGGGTGAAGG + Intergenic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
1062811725 10:471460-471482 AAAGTGAGGCTAAGGGATGACGG - Intronic
1063519212 10:6725787-6725809 AAAGTGCTGCAGATGGATGATGG - Intergenic
1064650935 10:17508600-17508622 AAATTGATACAGAGACATGAAGG + Intergenic
1065304184 10:24353020-24353042 AAGCTGATGTAGAGGGATGTGGG - Intronic
1066312682 10:34212919-34212941 AAATAGATGAAGAAAGATGAAGG - Intronic
1066533226 10:36363204-36363226 AAATTAAGGCAGAGAGATTAAGG - Intergenic
1066594443 10:37034562-37034584 GATTTGATGTAGAGGGAGGATGG + Intergenic
1066637505 10:37520770-37520792 AAATACATGGAGAGGGATAATGG + Intergenic
1067293862 10:44963189-44963211 GAGTTGAGCCAGAGGGATGATGG + Intronic
1068699416 10:60003991-60004013 AAATTGTTGCTGATGGATCAAGG - Intergenic
1069599048 10:69691612-69691634 AAATTGAGGCACAGGGAAGTTGG - Intronic
1070504212 10:77098875-77098897 AATAAGATGCAGAGGGGTGAGGG - Intronic
1071557403 10:86615407-86615429 AAATTGATGCCTAGAGATGAAGG + Intergenic
1072429559 10:95358888-95358910 ACAATGAAACAGAGGGATGAAGG - Intronic
1073401770 10:103263347-103263369 GAGCTCATGCAGAGGGATGAAGG + Intergenic
1073864710 10:107788204-107788226 AAATTGAGGCACAGAAATGAAGG + Intergenic
1074428583 10:113373620-113373642 AAACTGAAGCAAAGGGATGGAGG - Intergenic
1074498624 10:114002282-114002304 ATAGTGCTGCAGAGGGCTGATGG + Intergenic
1075120029 10:119658210-119658232 AAATTCATACAGTGGGAGGATGG + Intronic
1075898679 10:126020378-126020400 GAATTGATGCAGTGGTCTGAGGG + Intronic
1076468662 10:130703342-130703364 CAGTTGATGCAGGTGGATGAGGG - Intergenic
1076480402 10:130781553-130781575 AAATGGATGTGGAGGGATGTGGG - Intergenic
1077590373 11:3486366-3486388 AAGTTCTTGCAGTGGGATGATGG + Intergenic
1079473101 11:20799015-20799037 AAAATAAAACAGAGGGATGAGGG + Intronic
1084919555 11:72458124-72458146 AAAGTGAGGGAGAGGGAGGAAGG + Intergenic
1086776790 11:90845783-90845805 AAATCTATGCAGAGGAAAGAAGG + Intergenic
1087564702 11:99839462-99839484 AAGTTGAGGCAGAGGGAAGGAGG + Intronic
1087596751 11:100263707-100263729 AGATTGAAGCACAGGGTTGAAGG - Intronic
1088036070 11:105318048-105318070 AAATTGATTTAGAGTCATGAAGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1093304424 12:17495839-17495861 AAACTGGTGCAGAGAGATTAGGG + Intergenic
1093408611 12:18838251-18838273 AAAATAAGGCAAAGGGATGAGGG - Intergenic
1094734222 12:33215581-33215603 AAAGTGCTGCAGAGGGATGTGGG + Intergenic
1095359897 12:41324180-41324202 AATCTCATGCAGAGGAATGAAGG - Intronic
1095839867 12:46681500-46681522 TAATTAATGCAGAAGGAAGATGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096863124 12:54544374-54544396 AAGTTGCTGCAGGGGGATGGAGG + Exonic
1096869302 12:54583440-54583462 GACTAGATGCAGAGGGATGGAGG - Intronic
1097927868 12:65150448-65150470 AAATTAAAGGAGAGGGAAGAAGG - Intergenic
1098496029 12:71136535-71136557 AAACTGATGCAAAGGCAGGAAGG + Intronic
1099448310 12:82778319-82778341 AAATTGAAGAACAGGGAAGATGG - Intronic
1099679586 12:85807841-85807863 AACTTGATGCATAGTCATGATGG - Intronic
1099831583 12:87850229-87850251 AAATACATGCAGAGGGATGAGGG + Intergenic
1101341480 12:103845705-103845727 AAATTGATGAAGATAGGTGAAGG + Intergenic
1101866047 12:108520333-108520355 AAACTCAGGCAGAGGGGTGAGGG - Exonic
1103699303 12:122840449-122840471 AAACTGAGGCAGAGTGGTGAAGG - Intronic
1104084488 12:125461494-125461516 TAGTTGCTGCAGAGGGATGTGGG + Intronic
1104239222 12:126971240-126971262 AAATTGATGCACAGAGAAGGTGG - Intergenic
1107469679 13:40680596-40680618 AAATTGAGGCACAGGGAGGTTGG + Intergenic
1108246334 13:48517955-48517977 ACAGTGATGCACAGGGAAGAAGG + Intronic
1110485317 13:76034488-76034510 AAAGTGATCGAGAGAGATGAGGG - Intergenic
1110566044 13:76958492-76958514 AAACTGAGGCAGAGGGCTAATGG - Exonic
1111567397 13:90033291-90033313 AACTTGGTGCAGAGCGGTGAGGG - Intergenic
1112187515 13:97142073-97142095 AAATTGATAGAGAGGGAAAAGGG + Intergenic
1113887615 13:113669272-113669294 AAAATGAAGCAGAGTGGTGAGGG + Intronic
1114532924 14:23406676-23406698 AAACTGAGGCACAGGGAAGAGGG + Intronic
1115866136 14:37748541-37748563 AACTTGAGGCAGTGGGAAGAAGG - Intronic
1116376286 14:44206138-44206160 AATTAGATTCAGAGGCATGAGGG - Intergenic
1119406574 14:74402877-74402899 AAATTGCTGCACAGGGAAGTCGG - Intergenic
1120434570 14:84464628-84464650 AAATTAGTGGAGAGGAATGAAGG + Intergenic
1121164138 14:91775645-91775667 AAATAGCTCCAGAGCGATGAAGG + Intronic
1124486015 15:30117367-30117389 AAATTAATACACAGGGATCAGGG - Intergenic
1124517560 15:30379902-30379924 AAATTAATACACAGGGATCAGGG + Intronic
1124541090 15:30586353-30586375 AAATTAATACACAGGGATCAGGG - Intergenic
1124547801 15:30648139-30648161 AAATTAATACACAGGGATCAGGG - Intronic
1124757568 15:32421231-32421253 AAATTAATACACAGGGATCAGGG + Intergenic
1127043964 15:55006903-55006925 AAATGGATGCAGAGAGATCTGGG - Intergenic
1127372690 15:58355751-58355773 ATGTTGAGTCAGAGGGATGATGG - Intronic
1127768689 15:62212665-62212687 TAATGGTTGCAGAAGGATGAAGG + Intergenic
1129207668 15:74046629-74046651 AGATTGATGCAGATGGAAGGAGG + Exonic
1129816343 15:78557742-78557764 AAATTGATGCAGTGGGGGGTAGG - Intergenic
1131520253 15:93109146-93109168 AAATGGATGCAGAGCGATGGCGG + Intergenic
1133733052 16:8592265-8592287 ACATTGATGCTGAGACATGAAGG + Intergenic
1135187466 16:20327569-20327591 CAATTGGTGCACAGGTATGATGG + Intronic
1135911638 16:26566682-26566704 TCATTGATGGAGAGGGGTGAGGG + Intergenic
1141264909 16:82488059-82488081 AGATGGAGGCAGAGGGATAAAGG - Intergenic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1144812503 17:18009565-18009587 AAACTGAGGCACAGAGATGAAGG + Intronic
1145116859 17:20218314-20218336 AAACAGAGGCAGAGGGATTAAGG + Intronic
1146972525 17:37084353-37084375 AAACTGAGGCAGAGGGTTGACGG + Intergenic
1147370630 17:39990212-39990234 AAAAAGAGGCAAAGGGATGATGG - Intronic
1153183431 18:2460790-2460812 CAACTGCTGCTGAGGGATGAGGG + Intergenic
1153361878 18:4206761-4206783 AAATTGATGGAGATGAATGAAGG - Intronic
1153587388 18:6637126-6637148 AACTGGCTGCAGAGGGAGGATGG - Intergenic
1155555601 18:27015728-27015750 GAAATGATGCAGAGTGATAAAGG - Intronic
1156689317 18:39686831-39686853 AAATTGATGTAGAGGGAGATGGG - Intergenic
1157265295 18:46214245-46214267 AACTTGATGGAGTGAGATGATGG + Intronic
1157453644 18:47807074-47807096 AAATTGTTGCAGCTGGGTGATGG + Intergenic
1158009002 18:52706973-52706995 GAAATGATGCAGAGGGATGGAGG + Intronic
1158164501 18:54524506-54524528 AAATTGATGCAGAAAGTTGTTGG - Intergenic
1158335696 18:56413417-56413439 AAATTGATACAGAGGGAGTGGGG + Intergenic
1158503895 18:58028826-58028848 AAATGGATGGAGAGAGAGGAAGG + Intergenic
1158767704 18:60474772-60474794 AAAATGATGCAGTGGGAGAAGGG + Intergenic
1160618314 18:80150923-80150945 AAACTGAGGCAGAGCGAAGAGGG + Intronic
1160676567 19:394319-394341 AAGGTGATGGAGAAGGATGATGG + Intergenic
1160928239 19:1557071-1557093 AAACTGAGGCTGAGGGAAGAAGG - Intronic
1164286637 19:23822792-23822814 AGATTGGTGCATAGGGAGGAGGG + Intronic
1164511408 19:28900239-28900261 AAAGTATTGCAGAGGGAGGATGG - Intergenic
1166068131 19:40372029-40372051 AAATAGAGGCCGAGGGATGTTGG - Intronic
1166872625 19:45880062-45880084 AAATTGAATCAGAGGGATGGTGG - Intergenic
1167439271 19:49499147-49499169 AAACTGATGCTGAGCGATAAGGG + Intronic
1168460797 19:56555669-56555691 AAAATGATGCAGTAGGGTGAGGG + Exonic
925051768 2:821071-821093 AGTTTGATGCCGATGGATGAAGG + Intergenic
925236560 2:2283870-2283892 AAACTGAGGCAGAGGGAGGTCGG - Intronic
925922841 2:8648625-8648647 AAAGTGAGGCAGTGGGATGACGG + Intergenic
925987105 2:9225583-9225605 AAATTGATTCAGAAGGTTGTGGG + Intronic
926400155 2:12488644-12488666 AAATTGTTGCAGAAGGACAAGGG + Intergenic
926410190 2:12594909-12594931 ACATTGGTGCAGAGGCATGAGGG + Intergenic
926592372 2:14753114-14753136 AAACTGATGCATAGGGAGGTTGG - Intergenic
927060390 2:19413124-19413146 AAATTGATCAAGAGTGATGAGGG + Intergenic
928040620 2:27872892-27872914 GAATGGATGCAGAGGGGTAAAGG + Intronic
928504779 2:31939709-31939731 AAATTGATGCAGGGATAAGAGGG - Intronic
929780466 2:44953850-44953872 TAATTGATTCTGAGGGAAGAGGG + Intergenic
930052526 2:47227815-47227837 AAATGGCTGCAGAAGGAGGAGGG - Intergenic
930128172 2:47820598-47820620 AAATAGATGCAGAGAGCTGCAGG + Intronic
930261742 2:49154825-49154847 AAATTGATGCTGAAGACTGAAGG - Intergenic
934792165 2:97070564-97070586 AATTTGATGCAGGGGAAGGAAGG + Intergenic
934814455 2:97313145-97313167 AATTTGATGCAGGGGAAGGAAGG - Intergenic
934823238 2:97395338-97395360 AATTTGATGCAGGGGAAGGAAGG + Intergenic
934883200 2:98001301-98001323 AAGTTCATGCAGCAGGATGAGGG + Intergenic
938060814 2:128252874-128252896 AGATTGTGGCAGAGGGAAGATGG + Intronic
939469230 2:142598457-142598479 AAATTGCTGAAAAGAGATGATGG - Intergenic
940455434 2:153892259-153892281 ATATTGATGCAGTAGGATAAAGG + Intronic
943349629 2:186781911-186781933 AAATTGATGAAGGGGCATGATGG - Intergenic
945276639 2:207994399-207994421 ACAGTGATGCAGAGGGAAAAGGG + Intronic
945829893 2:214771067-214771089 GCATTTATGCAGCGGGATGAAGG + Intronic
946432509 2:219633169-219633191 ACACTGAGGCAGAGGGATGGAGG + Intronic
947887693 2:233587627-233587649 AAATTTATGCTGAGACATGAGGG - Intergenic
948260209 2:236598866-236598888 GAATGGATGCAGGGAGATGATGG + Intergenic
1168828353 20:829499-829521 AAAGTGAGGCAGAGGGCAGAAGG - Intergenic
1169538721 20:6576746-6576768 AAATTGATGCAGGAGGAACATGG + Intergenic
1169546908 20:6659857-6659879 AACTTGATCATGAGGGATGAAGG - Intergenic
1170404058 20:16018057-16018079 AATTTGATGAAGAGGGCTAAAGG - Intronic
1173240380 20:41290648-41290670 AAACAGATGCAGAGAGGTGAAGG + Intronic
1174437613 20:50522055-50522077 AAATTGAAGCAAAGGGCTAAAGG + Intronic
1175422646 20:58844548-58844570 AAACTGAGGCAGAGGGGTGTTGG - Intronic
1175657742 20:60786751-60786773 GAATGGATGCAGAGGCATAAAGG + Intergenic
1178032679 21:28545729-28545751 AAATTGGAGCAGAGGAAAGAAGG + Intergenic
1178118688 21:29444591-29444613 AAAGTGTTGCAGTGGGCTGAGGG + Intronic
1178195675 21:30342286-30342308 AAATTTATGCAGTGAGTTGATGG - Intergenic
1178512824 21:33220055-33220077 AAACAGATGAAGAGGGCTGAGGG + Intergenic
1178764351 21:35435277-35435299 AAGTTGATGCAATGGGATGCTGG + Intronic
1183063511 22:35349169-35349191 AAACTGAGGCTGAGGGAGGAAGG + Intergenic
1183220276 22:36507587-36507609 AAATGGAGACATAGGGATGAAGG + Intergenic
1183561667 22:38579610-38579632 AAATTGTTGAAGATGGGTGATGG - Intronic
1184045459 22:41970001-41970023 ATATGGCTGGAGAGGGATGAGGG + Intergenic
1184397619 22:44253040-44253062 AAAGTTCTACAGAGGGATGATGG + Intronic
1184941630 22:47770947-47770969 AATTAGATGCAGAGGGTTGATGG - Intergenic
949346856 3:3084776-3084798 AAACAGATGCAGAGAGGTGAAGG - Intronic
950094798 3:10322516-10322538 AAATTGTTGCAGGGGTGTGAGGG + Intergenic
950354115 3:12389527-12389549 AAATGGAAGCAGAAGGATAATGG + Intronic
950659778 3:14460056-14460078 AAACTGAGGCAGAGTGAAGAAGG - Intronic
951563408 3:23989557-23989579 GAAATGAGGCAGATGGATGAGGG - Intergenic
953026009 3:39145357-39145379 AAATGGGTGGAGAGGGAGGAGGG - Intronic
953284765 3:41595915-41595937 GAATAGCTGCAGAGGGATGTGGG + Intronic
953312709 3:41895065-41895087 AAATTAATACACAGGGATCAGGG + Intronic
957060417 3:75476871-75476893 AAGTTCTTGCAGTGGGATGATGG + Intergenic
960452629 3:117829237-117829259 GAATTATTGCAGAGGGCTGATGG - Intergenic
961072754 3:123950609-123950631 AAATGGTTACACAGGGATGAGGG + Intronic
961292971 3:125862534-125862556 AAGTTCTTGCAGTGGGATGATGG - Intergenic
961894211 3:130153874-130153896 AAGTTCTTGCAGTGGGATGATGG + Intergenic
964783714 3:160370751-160370773 AAATATATGTGGAGGGATGATGG - Intronic
965635780 3:170778994-170779016 CCATGGATGCAGAGGGCTGATGG + Intronic
966569607 3:181427041-181427063 AAATTGGTGGTGAGGGATTAAGG + Intergenic
967599247 3:191364826-191364848 AAAGTGAAGAAGAGGAATGAAGG - Intronic
969748556 4:9093202-9093224 AAGTTCTTGCAGTGGGATGATGG - Intergenic
969809594 4:9637767-9637789 AAATTCTCGCAGTGGGATGATGG - Intergenic
969922911 4:10557527-10557549 CCCTAGATGCAGAGGGATGAGGG - Intronic
971677204 4:29647069-29647091 ATATTAATGCAGAGAGATCACGG - Intergenic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
974773325 4:66444893-66444915 AAATTTATGGAGATGAATGATGG + Intergenic
976258219 4:83120655-83120677 AAATTGTTGAAGTTGGATGATGG - Intronic
976644655 4:87374856-87374878 AAATTCATTAAGAGGTATGAGGG + Intronic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
977174513 4:93803917-93803939 AATTGGATGCAGTGTGATGATGG - Intergenic
977268879 4:94889963-94889985 AAATAGAGGGAGAGGAATGAAGG + Intronic
978639238 4:110849560-110849582 AAATTGAGGAAGAGAGATGCTGG + Intergenic
979073944 4:116246293-116246315 AAAATAATGCAGAGGTATTACGG + Intergenic
979199874 4:117964523-117964545 AAATGGAAGCTGAAGGATGAGGG - Intergenic
979587029 4:122432587-122432609 AAAGTGCTGCAGAGGGGTCAAGG + Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
979889210 4:126068208-126068230 AAATTGATGTGGAGGGTAGATGG - Intergenic
980046386 4:127993517-127993539 AAATTGCTGCACAAGAATGACGG - Intronic
980649553 4:135694817-135694839 AAGATGATGCAGAAAGATGATGG - Intergenic
981892282 4:149752654-149752676 AAATTAATACAGAGGGGTGATGG + Intergenic
982125339 4:152179243-152179265 CAATCGATGCTGAGTGATGACGG - Intergenic
984460763 4:180033929-180033951 AAAATGATGTAGAGGGAGGTAGG - Intergenic
984609389 4:181820534-181820556 AAGCTGATGCTGAGGGGTGAAGG - Intergenic
986104426 5:4646086-4646108 ACTGTGATACAGAGGGATGATGG + Intergenic
986379012 5:7164096-7164118 AAATTGAGGCAGAGAGGTTATGG + Intergenic
986570265 5:9157145-9157167 AACCTGATGCAGAGGGAAGGGGG - Intronic
987367793 5:17164833-17164855 ACATTGAAACAGAAGGATGATGG + Intronic
989110209 5:37899844-37899866 GAATTCATGCAGAGTGACGAAGG - Intergenic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
989550778 5:42733789-42733811 TAATTGAGGCAGGGGTATGAAGG - Intergenic
990855907 5:60266082-60266104 AACTAGATGCAGCGGGAAGAAGG + Intronic
993996175 5:94726149-94726171 AAATTGAGGCAGAAGTTTGAGGG - Intronic
995287868 5:110412430-110412452 AAATTGAAATAGAGGCATGATGG - Intronic
995998426 5:118328385-118328407 AAATTGATGGAGGAGGATGAAGG - Intergenic
997559202 5:134830872-134830894 AAAGTGATCCAGTTGGATGAAGG - Intronic
997559464 5:134833435-134833457 AAATGTATGTAGAGGGGTGAGGG + Intronic
997619540 5:135276733-135276755 AAATTGTTGTGGAGGGGTGATGG - Intronic
998017747 5:138746031-138746053 AAATTGAGGCTAAGAGATGATGG + Intronic
998348136 5:141482732-141482754 AATTCCATGCAGAGGGATTATGG + Intronic
999109804 5:149109121-149109143 ATACTGATGCAGATGGGTGATGG - Intergenic
1001365953 5:171140092-171140114 AAATTTAAGCAGAGAGCTGAGGG - Intronic
1001441188 5:171744277-171744299 AAGCTGAGGCAGAGGGGTGACGG - Intergenic
1003259269 6:4502119-4502141 AAATTTCTGGAGATGGATGATGG - Intergenic
1004192844 6:13479257-13479279 AGCTTGATGCAGAGAGCTGAGGG + Intronic
1004442177 6:15663849-15663871 GAATTGACGGAGAGGGAGGAAGG - Intergenic
1005037131 6:21567074-21567096 AAGTTAAAGCAGGGGGATGAAGG - Intergenic
1006206028 6:32343816-32343838 AAAATGTTGGAGAGGGAAGATGG - Intronic
1006690673 6:35881946-35881968 AAAGTTATGAAGATGGATGATGG + Intronic
1007266346 6:40599211-40599233 AACTTGATGGAGAGGGAAGAAGG - Intergenic
1007445546 6:41902822-41902844 GAAGTCATGCAGAGAGATGAGGG - Intergenic
1007569128 6:42876615-42876637 AATTTTAAGCAGAGTGATGATGG - Intergenic
1009756252 6:67943708-67943730 AATTTGAGGCAGAGGGCAGAAGG + Intergenic
1009907033 6:69883056-69883078 ACATTTAAGCAGAGGCATGAAGG + Intronic
1010376469 6:75176308-75176330 AGAGTGATGCAGTGGGAGGAGGG + Intronic
1010376474 6:75176331-75176353 AGAGTGATGCAGTGGGAGGAGGG + Intronic
1010376491 6:75176400-75176422 AGAGTGATGCAGTGGGAGGAGGG + Intronic
1010376496 6:75176423-75176445 AAAGTGATGCAGTGGGAGGGAGG + Intronic
1012051755 6:94354925-94354947 AGATTTATGGACAGGGATGAAGG - Intergenic
1013414292 6:109911045-109911067 AAATTGAGGCAGAGGGCTGTGGG - Intergenic
1014053265 6:116981564-116981586 CAATTGTTGCACGGGGATGAGGG + Intergenic
1014872474 6:126613820-126613842 AAATTGATCAAGAGGAATAAAGG - Intergenic
1015114085 6:129627597-129627619 AAATTAATGAGGAGGGAGGAAGG + Intronic
1016931794 6:149418417-149418439 AAATTGAAGCAGAGGGACATGGG + Intergenic
1017333808 6:153231035-153231057 AAAATGATGCAGAGGGTAAAAGG + Intergenic
1018366405 6:163124282-163124304 AAATTGATGCTGGGGGAAAAAGG + Intronic
1019535574 7:1527922-1527944 AAATTTCTGGAGATGGATGATGG + Intergenic
1019892766 7:3959855-3959877 TAATTGAAGCATGGGGATGAGGG - Intronic
1020171769 7:5850599-5850621 AAAGTGCTGGAGATGGATGATGG + Intergenic
1020324438 7:6963448-6963470 AAGTTCTTGCAGTGGGATGATGG + Intergenic
1020805348 7:12783801-12783823 AAATTGGAGCAGAGAGATGGAGG + Intergenic
1024983475 7:55177034-55177056 AAAATGATGGAGGGGGAAGAGGG - Intronic
1025977830 7:66383282-66383304 AAATTAAGGCTGTGGGATGATGG - Intronic
1028920643 7:96306739-96306761 AACAAAATGCAGAGGGATGAAGG - Intronic
1030551428 7:110965811-110965833 AAATTGCTGTTGAGGGATTAGGG + Intronic
1030740830 7:113107743-113107765 AAATTTATGCAGGTGGAAGATGG + Intergenic
1030869590 7:114738637-114738659 AAATTTATGCACAGGGAAAAAGG - Intergenic
1031460964 7:122047984-122048006 TAATAGATGCAGAGGGAAAAGGG + Intronic
1032271219 7:130408705-130408727 AAATTGCTGCAGAGGGTCAAAGG - Intronic
1032613823 7:133444326-133444348 AAATTGATGCATATGGAAGGAGG - Intronic
1032657986 7:133952575-133952597 AAAGTTCTGCAGATGGATGATGG - Intronic
1035057823 7:156048014-156048036 AAATTTCTGGAGAGGGATGGTGG + Intergenic
1036371624 8:8167503-8167525 AAGTTCTTGCAGTGGGATGATGG - Intergenic
1036879279 8:12498141-12498163 AAGTTCTTGCAGTGGGATGATGG + Intergenic
1044384271 8:91568687-91568709 CGATTGATGCAGATGGAAGAGGG - Intergenic
1044581699 8:93832099-93832121 AAGATGATACAGAGGAATGAGGG - Intergenic
1045754611 8:105528103-105528125 AAATGGATGCAGAGGGCTGCAGG + Intronic
1045769029 8:105712463-105712485 AAACTGATGCGGAGGTATGTCGG + Intronic
1046439324 8:114237521-114237543 AAATTAATGCAGAAGTTTGAAGG + Intergenic
1047306551 8:123657556-123657578 AAACTGAGACTGAGGGATGAGGG + Intergenic
1048909699 8:139123301-139123323 TAATTGATGGAAAGGGAAGATGG + Intergenic
1050203889 9:3177627-3177649 TAATTCAGGCAGAGGGACGATGG - Intergenic
1050559325 9:6818548-6818570 AAATTGATGGTGAGGGATGTGGG + Intronic
1050890011 9:10812761-10812783 AGATTGATGGAGATGGAGGATGG - Intergenic
1052081853 9:24215619-24215641 AAAGTGAGGATGAGGGATGAAGG + Intergenic
1052502424 9:29308459-29308481 AACTTGATACACAGGGATTATGG + Intergenic
1052913088 9:33901878-33901900 AAAAACATTCAGAGGGATGATGG - Intronic
1053377587 9:37621060-37621082 AAATTGATGGAGAGGGAAGAAGG + Intronic
1054971035 9:71087132-71087154 AAGTTCTTGCTGAGGGATGAGGG - Intronic
1055122083 9:72672135-72672157 AAAGTGATCCAGTTGGATGAAGG - Intronic
1056712098 9:88999357-88999379 AAATTGATGTAGGGAGAGGAGGG + Exonic
1056870657 9:90274740-90274762 ATACTCATGCAGAGGGATGGAGG - Intergenic
1057511893 9:95687370-95687392 AAAATGGTGCAGAGTGTTGAAGG + Intergenic
1058295202 9:103297579-103297601 AAACTGATGCAGAGTGTTGGTGG - Intergenic
1059947122 9:119420823-119420845 TAATTGATGCAGAGGAAGGAAGG + Intergenic
1059995343 9:119903438-119903460 AAATTGAGACAGAGAGGTGAAGG + Intergenic
1061796587 9:133088932-133088954 AAACCGAAGCAGAGGGATGGCGG - Intergenic
1185642426 X:1596190-1596212 AAAATGAAGTAGAGGGTTGATGG + Intronic
1186174492 X:6910777-6910799 AAATTTATGCATAGGAATGGTGG - Intergenic
1186220093 X:7341424-7341446 ACATTCATGGAGAGGGAGGAGGG - Intronic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1188267012 X:28089398-28089420 AAGATGATGCAGAGAGAAGATGG - Intergenic
1189353384 X:40293937-40293959 AAAAGGATGCAGGGGGATGGGGG + Intergenic
1189623655 X:42871564-42871586 AAATTTATGCCGAGGGAGGGAGG - Intergenic
1192915904 X:75651227-75651249 TAATTGATCAAGAGGGAGGAAGG - Intergenic
1193178137 X:78419722-78419744 AAATTTGTGAAGATGGATGATGG + Intergenic
1194297563 X:92144765-92144787 AAATTGATGCAGAGGGATGAAGG + Intronic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1195448216 X:104977526-104977548 AAATTGGTGGAGAGGTAAGATGG - Intronic
1196195100 X:112831294-112831316 GAATAGATGGAGAGGGATTAGGG - Intronic
1196785437 X:119417745-119417767 AAATAGATGCAAAGTCATGATGG + Intronic
1198153869 X:133938084-133938106 AAATTGATGAAGGGGAAGGATGG + Intronic
1198418995 X:136449992-136450014 AAATGGCTGCCGTGGGATGAGGG + Intergenic
1198670776 X:139078145-139078167 AAAGTGATGGGGAGGGAAGAAGG + Intronic
1200615137 Y:5369666-5369688 AAATTGATGCAGAGGGATGAAGG + Intronic
1201239959 Y:11949192-11949214 TGACTGAGGCAGAGGGATGATGG + Intergenic
1201273295 Y:12276538-12276560 AACTTGAAGAAGAGGGATGAGGG + Intergenic
1201560770 Y:15314038-15314060 AAATTTATGCATAGGAATGGTGG + Intergenic