ID: 1200617551

View in Genome Browser
Species Human (GRCh38)
Location Y:5398113-5398135
Sequence GAGTCTTATTTTTACATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200617549_1200617551 29 Left 1200617549 Y:5398061-5398083 CCTGAGATTATTCTTAAAGAAAT 0: 2
1: 1
2: 1
3: 38
4: 527
Right 1200617551 Y:5398113-5398135 GAGTCTTATTTTTACATGCATGG 0: 2
1: 0
2: 1
3: 14
4: 227
1200617550_1200617551 -2 Left 1200617550 Y:5398092-5398114 CCTTGTATGTTTACAATGAATGA 0: 1
1: 0
2: 1
3: 22
4: 235
Right 1200617551 Y:5398113-5398135 GAGTCTTATTTTTACATGCATGG 0: 2
1: 0
2: 1
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200617551 Original CRISPR GAGTCTTATTTTTACATGCA TGG Intronic
907885936 1:58592391-58592413 GAGTCTTATTTTTCTACTCAAGG - Intergenic
910038274 1:82815482-82815504 GAGTTTTATTTTTATTTTCAGGG - Intergenic
910362321 1:86425881-86425903 CAGTCATATTTTTATATGCATGG - Intronic
910375538 1:86565742-86565764 TAGTTTGATTTTTAAATGCATGG + Intronic
912648393 1:111416453-111416475 GACTGTTACTTTTACAGGCATGG - Exonic
912717662 1:111993396-111993418 CATTTTTATTGTTACATGCATGG - Intergenic
913707098 1:121436048-121436070 GAGTCTGATTATTAAATGCCTGG - Intergenic
916339992 1:163722683-163722705 GTGGCTAATTTTTACACGCAGGG - Intergenic
916632206 1:166628461-166628483 GACTTTTATTTTTACATACAGGG + Intergenic
917005005 1:170405427-170405449 GAGGCTTTTTTTGAAATGCAAGG - Intergenic
919019864 1:192091631-192091653 GAGTCTGATCTATACATGTATGG + Intergenic
919174669 1:194003228-194003250 GAGTTTTTTCTCTACATGCAAGG - Intergenic
920262851 1:204701367-204701389 GAATCATATTGTAACATGCATGG - Intergenic
922736661 1:227987025-227987047 GAGTCTTATTTTGTCATACATGG - Intergenic
922938848 1:229443328-229443350 AAGTCTTATTTTGCCAGGCACGG - Intronic
923061621 1:230480692-230480714 ATGTCTTATTTTTACATGCAGGG - Intergenic
924380789 1:243462310-243462332 GAGGGTTATTTTTAGAGGCAGGG - Intronic
924663319 1:246043179-246043201 TTGTCTTGTTTTTACATGAAAGG - Intronic
1063001006 10:1923011-1923033 GAGTCTTTTGTATACATGCATGG - Intergenic
1064316176 10:14259754-14259776 GACTGCTATTTTTCCATGCAGGG + Intronic
1065128438 10:22596683-22596705 GAGGTTTATTTATACATGGAGGG - Intronic
1065396353 10:25242771-25242793 GAGTCTTTCTGTTACATTCAGGG + Intronic
1065713404 10:28539316-28539338 AAGTCTTATTTTAACTAGCAAGG - Intronic
1068056679 10:52020161-52020183 CAGTCTGATTTTTATATGTATGG - Intronic
1068459795 10:57312550-57312572 AAGTATTTTTTTTACATGTATGG + Intergenic
1068733798 10:60389323-60389345 AAGGGTTATTTTTACATGCTGGG - Intronic
1074703231 10:116110334-116110356 GTGTCTGTGTTTTACATGCAGGG + Intronic
1077954675 11:7002790-7002812 GACTATTATTTTTACATGGGAGG - Exonic
1082769505 11:57195980-57196002 GATTCATATTTTTAAATGAATGG - Intergenic
1082855220 11:57800070-57800092 GAGGCTTTTTGTTCCATGCATGG + Intronic
1084454243 11:69258252-69258274 GAGCCTTATTTTTAGACCCAGGG + Intergenic
1084745995 11:71169726-71169748 GAGTCTTATTCTTTCACCCAGGG - Intronic
1086681140 11:89674231-89674253 ACTTCTTATTTTTACATGCTTGG - Intergenic
1087315271 11:96595161-96595183 AAGCCATATTTTTAAATGCATGG + Intergenic
1088212043 11:107467007-107467029 GATTCTTAATTTTATATGGAAGG - Intergenic
1088668281 11:112116640-112116662 GTGTTTTTTTTTTACTTGCATGG - Intronic
1088862118 11:113810486-113810508 GAGCCTTGTTATTGCATGCATGG - Intronic
1089274714 11:117326960-117326982 GAGTTTTAGTTTTGCTTGCACGG - Intronic
1091012456 11:132016099-132016121 GAGTTTTTTTTTTTCACGCAAGG + Intronic
1094565212 12:31592242-31592264 AAGTTTTATTTTTACTTACATGG - Intergenic
1099517527 12:83616050-83616072 AACTCTTATTTATACCTGCATGG + Intergenic
1100839305 12:98595684-98595706 GAGTTTTATATTAAAATGCATGG + Intronic
1100969905 12:100057320-100057342 AAGACTTATTTATACATACAGGG - Intronic
1100975353 12:100116541-100116563 GAGAGTTATTTTTTCATGAATGG - Intronic
1101769911 12:107740003-107740025 GAATCTTATTTTTGCATTCTTGG - Intronic
1102687296 12:114734832-114734854 GACCCTTATTTTGACATGGATGG - Intergenic
1105406797 13:20139253-20139275 GAGTATTATATTTACATACATGG - Exonic
1105742651 13:23343853-23343875 ATGTCTTATTGTTACATGAAAGG - Intronic
1106633249 13:31499341-31499363 GATTTTTATTTTTTCATACATGG - Intergenic
1106912671 13:34479829-34479851 CATTCTTATTCTTATATGCAAGG - Intergenic
1107520596 13:41176815-41176837 CAGTCTTATTTTTAGAGACAGGG + Intergenic
1109937884 13:69316874-69316896 GAGTGTTATTATTTCATTCAAGG - Intergenic
1110230853 13:73165790-73165812 TAGCCTTATTTTTAGATACAGGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1114302175 14:21388112-21388134 GAGGCTTATTTTTATATTAATGG - Intronic
1116504463 14:45661696-45661718 GAGTTTTTTTTTAACATGAAGGG + Intergenic
1117056541 14:51917608-51917630 AAGTCTGATTTTTACTTTCAGGG - Intronic
1118006975 14:61572071-61572093 GAGTGTTGTTTTTAAAAGCAGGG + Intronic
1118055515 14:62075543-62075565 GACTCTTTTATTGACATGCATGG - Intronic
1118178303 14:63464709-63464731 TTTTCTTAATTTTACATGCAAGG - Intronic
1118839291 14:69499194-69499216 GAGTTTAAAGTTTACATGCAGGG - Intronic
1119256932 14:73206805-73206827 GATTCTTACTTTTACATGTTTGG - Intronic
1119910726 14:78346898-78346920 CAGTCATGTTTTTACGTGCAGGG + Intronic
1120229186 14:81824120-81824142 CATTCTAATTTTTACATGCATGG - Intergenic
1121670442 14:95706607-95706629 GAGTGTGTTTTTTTCATGCAGGG - Intergenic
1124973056 15:34508865-34508887 GAGTATCATTTTTACTTGAAAGG + Intergenic
1126616589 15:50588479-50588501 GAGTCTACTTTTTATATGTAGGG + Intronic
1127516978 15:59705554-59705576 GAGTTTTACTTTTAAATTCAAGG - Intergenic
1129307691 15:74679579-74679601 GAATTTTATGTTTACATTCATGG - Intronic
1131396991 15:92094010-92094032 GACTCTTATTTTTGCCTCCAGGG + Intronic
1131728797 15:95256768-95256790 GAGTCTTATCTGTACATAGAAGG + Intergenic
1131839382 15:96419264-96419286 GAGTCTTATTTTGTCATTCTAGG + Intergenic
1132297877 15:100756197-100756219 GAGTATTATTCTTACATTTAAGG - Intergenic
1133875925 16:9734245-9734267 GAATCTTATTTTTAAATGCCCGG - Intergenic
1134387321 16:13785887-13785909 GAGTCCTATATTTACAGACATGG + Intergenic
1137654574 16:50149165-50149187 TATTATTATTTTTACAGGCAGGG + Intergenic
1137926108 16:52544429-52544451 TAGTTATATTTTTACTTGCAAGG + Intronic
1138055289 16:53826518-53826540 GGGTCATATTATTACATACAGGG - Intronic
1138549249 16:57738575-57738597 GAGTCTTATGGTTAAATTCATGG - Intronic
1140387886 16:74558529-74558551 GAGTCTGACTTTAACCTGCATGG + Intronic
1141233001 16:82188075-82188097 GAGTCTTGGTTTTACATGCTGGG + Intergenic
1142663797 17:1449894-1449916 GGGTATTATTTTTAAAGGCATGG - Intronic
1146414903 17:32622704-32622726 GACTCTGATTTCTACAGGCATGG + Intronic
1147395110 17:40136496-40136518 TAGTCTTATTTTTCCCTACATGG + Intronic
1147865122 17:43546580-43546602 GAGTTTTATTTTTTTATGAATGG - Intronic
1148114506 17:45167591-45167613 GACTCTTATTTTTAGAGACAGGG - Intronic
1148923179 17:51058361-51058383 AAGTATTATTATTACATCCATGG + Intronic
1149738988 17:59025335-59025357 GGGTCTTATTTTTATTTGGAAGG - Intronic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1155012154 18:21790108-21790130 TAGTTTTAATTTTCCATGCATGG - Intronic
1156644743 18:39147523-39147545 ATGTCTAATTTTTAGATGCAAGG - Intergenic
1157115529 18:44859310-44859332 AAGTCTGACTTTTACCTGCATGG + Intronic
1158371401 18:56809590-56809612 GACTCTTATTTTTTTTTGCAAGG + Intronic
1159230644 18:65604299-65604321 GAGTCGTATTTTGATATGCTAGG - Intergenic
1159884936 18:73894882-73894904 GGGTCTGATTATTTCATGCAGGG + Intergenic
1162560139 19:11412660-11412682 GAATTTTATTTTTAGATACAGGG - Intronic
1163843500 19:19626211-19626233 GAGTCTTATTTTGAGTTTCATGG - Intronic
1164853662 19:31504175-31504197 GTGTCTTATTTTTAGCAGCAGGG + Intergenic
1164973853 19:32556216-32556238 ACGTCTTATTTCTAAATGCAAGG - Intergenic
1165302612 19:34980390-34980412 GAGTCTGTTTGTTATATGCAGGG - Intergenic
1166034807 19:40160364-40160386 AAGTTTTATTTTTAGATACAGGG - Intergenic
1166466208 19:43033094-43033116 GAGTCTTATTTTGACATCTTGGG + Intronic
1166500681 19:43338732-43338754 GAGAATTTTTATTACATGCATGG - Intergenic
1167950659 19:53024683-53024705 CAGTCTTTTTTTTTCATGCAGGG - Intergenic
1168363297 19:55761702-55761724 GGCTTTTATCTTTACATGCATGG - Intronic
1168364251 19:55771705-55771727 GGCTTTTATCTTTACATGCATGG - Intronic
929422565 2:41808193-41808215 TGGTCTTTTTTTTACATGAAGGG - Intergenic
930138252 2:47924550-47924572 CAGTTTAATTTTTACATGCATGG - Intergenic
930445411 2:51464783-51464805 GTATTTTATATTTACATGCATGG + Intergenic
930451919 2:51551468-51551490 TAGTTTTTTTTTTACATGCATGG + Intergenic
930738641 2:54806250-54806272 TAGTCTTATTTTTAAATTCAAGG + Intronic
931300686 2:60975108-60975130 GAGCCTTATTTCAAAATGCATGG + Intronic
932450939 2:71810474-71810496 TAGTATTTTTTTTAAATGCAAGG - Intergenic
932792983 2:74672087-74672109 CAGTTTTATTCTTACCTGCAGGG + Intronic
936768946 2:115888375-115888397 GAGACTTATTTTTCCTTGCTTGG + Intergenic
937635330 2:124149737-124149759 GAGTTTTATTTTTATAGTCAGGG - Intronic
937805122 2:126130934-126130956 AAGTCTTATTTATTTATGCATGG + Intergenic
938693842 2:133816697-133816719 AAGTCTTATGTTTAAATACATGG - Intergenic
939228751 2:139398821-139398843 GAGTTTTTTTTTAACATGAAGGG - Intergenic
940394796 2:153175723-153175745 GACTCATATTTTTAAATGTAAGG + Intergenic
940571054 2:155434159-155434181 GAATCTTAATTTTTCATACAAGG - Intergenic
941531693 2:166678514-166678536 CATTTTTATTTTTACATTCATGG - Intergenic
943118755 2:183708136-183708158 GAGATTTATTTTTACTTGCTTGG - Intergenic
944654245 2:201862011-201862033 GACTTTTGTTTTTACTTGCATGG + Intronic
946271756 2:218600062-218600084 GAATCTTATATCTACATTCATGG - Intergenic
946579683 2:221114788-221114810 GAGTCTAATGTTTACAGTCATGG + Intergenic
1169035141 20:2444572-2444594 GCATCTTCATTTTACATGCAGGG - Intergenic
1169873672 20:10273480-10273502 GAGTCATTTTTCTCCATGCAGGG + Intronic
1170941239 20:20849657-20849679 GAGTCTTTTTTTTACATCAGTGG + Intergenic
1175619997 20:60435439-60435461 CAGTTTTATTTTTCCATCCAAGG - Intergenic
1176379173 21:6103222-6103244 GAGTTTCATTTTTAACTGCATGG + Intergenic
1176663518 21:9662609-9662631 ATGTCTTAATGTTACATGCATGG - Intergenic
1177194171 21:17885061-17885083 GATTATTATGTTTACCTGCAGGG + Intergenic
1177507144 21:22033927-22033949 GTTTCTTTTTCTTACATGCACGG - Intergenic
1179304321 21:40141171-40141193 GAGCCCTATGTTTACCTGCATGG + Intronic
1179669753 21:42938369-42938391 GACTTTTATTTTTAAATGTACGG + Intergenic
1179744300 21:43435015-43435037 GAGTTTCATTTTTAACTGCATGG - Intergenic
1180884751 22:19233686-19233708 GATTTTTGTTTTTACATACAAGG - Intronic
1181986717 22:26805042-26805064 GAGTGTCCTGTTTACATGCAGGG + Intergenic
949097467 3:102589-102611 CACTCTTATATTTACCTGCAAGG - Intergenic
950175688 3:10872623-10872645 CAGTCTTATTTTTACCTTCCAGG + Intronic
951255878 3:20448499-20448521 TGGTCTTATTTTCGCATGCAAGG + Intergenic
951694433 3:25430781-25430803 GTGTCTTATTTTTGTAAGCAGGG + Intronic
953176282 3:40555918-40555940 GAGAAATAGTTTTACATGCAAGG - Intronic
953181642 3:40600578-40600600 GAGACATAATTTTAAATGCATGG + Intergenic
953906167 3:46869234-46869256 GAGTCTTTTTTTTTCTTCCAAGG - Intronic
954027868 3:47797336-47797358 GAGTCTTGTTTCTACCGGCATGG - Intergenic
956070747 3:65448288-65448310 AAATCCTATTTTGACATGCAAGG - Intronic
957164825 3:76658817-76658839 GAGTCATATCTTTTCATGCTAGG + Intronic
957853041 3:85835778-85835800 GAGTCTGTTTTTTGCAAGCAAGG - Intronic
958147548 3:89646062-89646084 AAGTCATATTTTTACATATATGG - Intergenic
958873185 3:99585392-99585414 GATTCTCATTTTTACATAAATGG + Intergenic
958875698 3:99614217-99614239 TTGTCTTATTTTTATATGCTTGG + Intergenic
965328029 3:167332013-167332035 GAGTCTTATTTTTAATTTAATGG - Intronic
967783325 3:193463362-193463384 GAGTGAAATTTTTACCTGCAGGG + Intronic
967795484 3:193594019-193594041 GAGACTTACTTTTTGATGCAAGG + Intronic
969281698 4:6175030-6175052 GAGTTTGGTTTTTACCTGCAGGG - Intronic
970303427 4:14705354-14705376 GAGTCTAATATTTGCAGGCATGG - Intergenic
970306887 4:14742364-14742386 GAGTCTTATTCTCACAAGTAGGG - Intergenic
971537765 4:27775508-27775530 GTGACTGATTTTTACATGTAGGG + Intergenic
973272243 4:48273146-48273168 GAGTCTTCTTTTTGGAGGCAGGG - Intergenic
975654335 4:76626557-76626579 TAATCTTAGTTTAACATGCATGG + Intronic
976208466 4:82643976-82643998 GTGTCTTACTTTGAGATGCAAGG + Intronic
976332233 4:83845676-83845698 GAGTCTCAATCTAACATGCATGG - Intergenic
977787952 4:101061884-101061906 CAGGCTTCTTTTCACATGCATGG - Intronic
978921482 4:114188482-114188504 AAATCTTATTTTTGCATGTATGG + Intergenic
983170450 4:164530173-164530195 GAGTATAATGTTTACAAGCACGG - Intergenic
984553639 4:181188648-181188670 GAGTCTTTCTTTGACAGGCAAGG - Intergenic
984566239 4:181334168-181334190 GAGAGTTATTTAAACATGCATGG + Intergenic
984584954 4:181553127-181553149 GAGAATTATTTTTAAATGAATGG + Intergenic
985018175 4:185659377-185659399 GAATGTTATTTTCACATTCAAGG - Intronic
985712032 5:1434857-1434879 GAGTCTTCTTTTTGCTTTCAAGG - Intronic
985992701 5:3576492-3576514 GAGTCTTACTTTAAAATTCACGG - Intergenic
987962920 5:24833392-24833414 GAGTTTTTTTTTTACATTTAGGG - Intergenic
988665960 5:33327849-33327871 GAGTATTATTTCTACATGTTGGG - Intergenic
990986199 5:61643035-61643057 GTGTCTTATTTTTGCAGACAAGG + Intronic
991031257 5:62084795-62084817 GAGCCTAATCTTTAGATGCAAGG + Intergenic
992428829 5:76687480-76687502 GAGTCTTTTTCTTGCAGGCAAGG + Intronic
993113121 5:83684293-83684315 GAGCCTTATTTCTACTTGCCTGG - Intronic
993682840 5:90900983-90901005 GAATTTTATTTCTATATGCAGGG + Intronic
996997346 5:129714011-129714033 GATTATTACTTTTACTTGCATGG - Intronic
997717941 5:136056022-136056044 GAGTGTAATCTTCACATGCATGG + Intronic
1008161545 6:48082538-48082560 GAGTCTTATTTTTAATCACAGGG - Intergenic
1009337698 6:62513500-62513522 GATTCTTAATTTTAAATTCAAGG + Intergenic
1009573889 6:65426867-65426889 GAATCTTTTGTTTACATACATGG + Intronic
1011232422 6:85178009-85178031 GAGTTTTATTCTTAAATGCCTGG + Intergenic
1012302811 6:97611094-97611116 GACTGTTACTTTTACATACATGG + Intergenic
1015052225 6:128855361-128855383 GAGTCTTTTTTTTACTTCCAAGG + Intergenic
1020848073 7:13312617-13312639 TAGTTTTATTAATACATGCAAGG + Intergenic
1021704425 7:23352602-23352624 GATCTTTATTTTAACATGCAAGG + Intronic
1023405008 7:39824351-39824373 TAGTCTTATTTTCAACTGCAAGG - Intergenic
1024531963 7:50400810-50400832 GATTTTTATTTTTAGAGGCAGGG + Exonic
1024690659 7:51798828-51798850 GTGTCTTATTTATGCATACAAGG - Intergenic
1024838553 7:53555560-53555582 TAATATTATTATTACATGCATGG + Intergenic
1025707402 7:63880232-63880254 TAGACTTATTTTCATATGCAGGG + Intergenic
1028102586 7:86839272-86839294 GGGTTTTATGTGTACATGCATGG + Exonic
1032995984 7:137447170-137447192 GAGAAATATTTTTAAATGCATGG - Intronic
1034250156 7:149683679-149683701 GAGAAATAGTTTTACATGCAAGG - Intergenic
1035911885 8:3576256-3576278 TATTATTATTTTGACATGCATGG - Intronic
1037352207 8:17972605-17972627 GAGTTTTATCTTTAGATGCCAGG - Exonic
1038803543 8:30770639-30770661 GAGTCATACTTTTACATGAAAGG - Intergenic
1040149537 8:44097451-44097473 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040151992 8:44133828-44133850 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040157567 8:44216384-44216406 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040158906 8:44236195-44236217 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040174476 8:44466709-44466731 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040200911 8:44858048-44858070 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040206599 8:44942472-44942494 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040207853 8:44960971-44960993 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040218599 8:45120026-45120048 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040225853 8:45227097-45227119 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040240026 8:45436040-45436062 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040246530 8:45531681-45531703 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040260325 8:45735300-45735322 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040262060 8:45760947-45760969 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040264680 8:45799677-45799699 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040269733 8:45874350-45874372 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040605684 8:48928901-48928923 GACTTTCATTTTTAAATGCAAGG - Intergenic
1041442591 8:57913340-57913362 CAGTCTCATTTTTACTAGCATGG + Intergenic
1041578178 8:59423720-59423742 CAGTCTTATTTCTAAATCCAGGG - Intergenic
1041631502 8:60093780-60093802 AAATCTTATTTTCACATGAAAGG - Intergenic
1042584212 8:70317324-70317346 CAGTCTTATTTTTTCATGTCTGG - Intronic
1044081376 8:87889450-87889472 ATGTCTTCTTTTTACATACAGGG + Intergenic
1046975412 8:120270418-120270440 GGGTGTTATTTTTACATACTAGG + Intronic
1050213099 9:3287102-3287124 GTGTCTTATCTCTGCATGCAGGG + Intronic
1050623475 9:7478677-7478699 AAGTCTTATTTTAATATGCCAGG + Intergenic
1050702087 9:8351986-8352008 GTGTTTTATTTTTCCATGCTGGG + Intronic
1051028307 9:12641614-12641636 TAGTCTTATTTTTAGATTAAGGG + Intergenic
1051820262 9:21157538-21157560 GAGTCTTATTTTTGTTTGCTTGG - Intergenic
1052203109 9:25806318-25806340 CAGTGATATTTTTAAATGCAGGG - Intergenic
1056188886 9:84165524-84165546 GAGACTTTTTTTTTCATGAATGG - Intergenic
1057908820 9:99002633-99002655 GAGTCTCATTTTAACATCCTGGG + Intronic
1203662581 Un_KI270753v1:59153-59175 ATGTCTTAATGTTACATGCATGG + Intergenic
1187484528 X:19689925-19689947 GGCTCTCATTTTTATATGCAAGG + Intronic
1189864745 X:45314998-45315020 GTTTCTTATTTTTAAATGGAGGG - Intergenic
1189991586 X:46600561-46600583 TAGTCTTATTTTTGTAAGCAGGG - Intronic
1190337936 X:49274093-49274115 GAGTACTATATTTTCATGCAAGG + Intronic
1191749362 X:64524931-64524953 GAGTTTTCTTTTAACATGAATGG - Intergenic
1194299880 X:92172816-92172838 GAGTCTTATTTTTACATGCATGG + Intronic
1194884405 X:99295184-99295206 GAGACTAATTTTATCATGCAGGG - Intergenic
1196826684 X:119746263-119746285 AAGTCTTATTTTGCCAGGCACGG - Intergenic
1198176502 X:134160884-134160906 GAGTTTAATTTTCACATCCAAGG + Intergenic
1200617551 Y:5398113-5398135 GAGTCTTATTTTTACATGCATGG + Intronic
1200721355 Y:6610445-6610467 GATACTTATTTTTAAATTCAAGG + Intergenic