ID: 1200623584

View in Genome Browser
Species Human (GRCh38)
Location Y:5483626-5483648
Sequence ATTAAAGCCAGAATCCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200623583_1200623584 12 Left 1200623583 Y:5483591-5483613 CCTTTCTCTTAAGCTCAATGCTA 0: 2
1: 0
2: 2
3: 25
4: 259
Right 1200623584 Y:5483626-5483648 ATTAAAGCCAGAATCCATGTAGG 0: 2
1: 0
2: 1
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200623584 Original CRISPR ATTAAAGCCAGAATCCATGT AGG Intronic
900705094 1:4075592-4075614 ATTAAACACAGAGTCCCTGTCGG - Intergenic
901416204 1:9118536-9118558 ATGAAAGCCAGACTCCAAGTCGG + Intronic
902313863 1:15603105-15603127 ATTCAAGACAGAAACCATTTCGG + Intergenic
908239221 1:62174754-62174776 AACAAAGCAAGACTCCATGTCGG + Intergenic
909092131 1:71239412-71239434 ATTAACATCAGAATCCATTTAGG + Intergenic
910337323 1:86149242-86149264 ATTAAAATCAGAATCTCTGTGGG - Intronic
911034101 1:93520753-93520775 ATAAAAGCCAGGATTCAGGTTGG + Intronic
911142629 1:94522394-94522416 ATAAAATCCAGAATACCTGTAGG - Intergenic
911755484 1:101549162-101549184 ATTAAAGCTGGAATGCAGGTTGG + Intergenic
912352296 1:109025713-109025735 AATAGAGCCAGACTCCATCTCGG + Intronic
916306624 1:163342059-163342081 ATTAAAGCCAAAAACCATAAAGG - Intronic
916513094 1:165490664-165490686 ATTAAAACCAGAATAAAGGTAGG + Intergenic
919141030 1:193571878-193571900 ATTTAAGCCTTAATCCATCTTGG + Intergenic
919543799 1:198885926-198885948 AGCAAAGCCAGAATCCATTTTGG - Intergenic
1063862811 10:10330446-10330468 ATTAAACCCAGAAAATATGTAGG - Intergenic
1064881017 10:20054018-20054040 ATTAAAGCCAGATTGTATTTAGG + Intronic
1066130373 10:32387444-32387466 ATTAATAACAGAATCCATGCAGG + Intergenic
1067932582 10:50577599-50577621 ATTAAAGCCACAAACAATCTAGG - Intronic
1074708711 10:116159069-116159091 AATATAGCCAGGATGCATGTTGG - Intronic
1078944977 11:16055490-16055512 ATAAAAGCCAGAATCCAAAGGGG + Intronic
1079529237 11:21429465-21429487 ATTATAGACAGAAGCTATGTTGG + Intronic
1083185716 11:61016756-61016778 ATAAAAGCCAGAATGGATATTGG + Intronic
1083410858 11:62491397-62491419 ATTAAACCCAGAAGCCAGGGTGG - Intronic
1083711138 11:64549344-64549366 TTTAAATCCAGAATGCTTGTTGG - Intergenic
1087212392 11:95457350-95457372 AGTAAGGCCAGAAGCCATGGGGG - Intergenic
1087574528 11:99973703-99973725 AATAAATCCAGAATCCTTGCAGG - Intronic
1092640251 12:10499026-10499048 AACAAAGACAGAATCAATGTAGG - Intergenic
1094071631 12:26421658-26421680 ATTATAGCAAGGGTCCATGTGGG + Intronic
1095734028 12:45536667-45536689 ACCAAAGCCAGAATACATTTTGG + Intergenic
1097275116 12:57807788-57807810 ACTAAAGAGAGAATCCAGGTGGG + Intronic
1098482647 12:70983926-70983948 ATTCCAGCGAGAATCCCTGTGGG + Intergenic
1099986409 12:89670555-89670577 ATCAAAGTCAGAATGCCTGTTGG - Intronic
1100690733 12:97036181-97036203 AGTAAAGCTAGAAACTATGTGGG + Intergenic
1101417774 12:104523340-104523362 ATTGGAGCCAGAATTCAAGTTGG - Intronic
1101647051 12:106641079-106641101 ATTAAAGCAAGAATGTTTGTTGG - Intronic
1104310206 12:127647756-127647778 AGTAAAGCCAGAATTCCTGACGG - Intergenic
1105624990 13:22104049-22104071 AGTAAACGCAGAATCCATGATGG - Intergenic
1106668397 13:31877945-31877967 ATTAAAGAAAGAAGCTATGTTGG + Intergenic
1107115790 13:36743832-36743854 AGAAAAGGAAGAATCCATGTGGG - Intergenic
1107859936 13:44651054-44651076 ATTAAGGCCAGAGTGCAGGTTGG + Intergenic
1110588836 13:77229570-77229592 ATTAAAGCTAGTATTCATGGAGG + Intronic
1111202272 13:84954275-84954297 ATTCAATCCAGAGTCCAGGTAGG + Intergenic
1112188121 13:97147674-97147696 ATTACAGCCAGAGTCCGTGTAGG + Intergenic
1113243082 13:108361836-108361858 ATCAAAGCCAGCAACGATGTGGG + Intergenic
1113792666 13:113037553-113037575 ATTAGAGCCAGAATGGAAGTAGG - Intronic
1114636513 14:24190139-24190161 ATTAAAGTCAGAAACCAGGAAGG + Intronic
1114822439 14:26037492-26037514 AGCAAAGCCAGAATCCATTTTGG - Intergenic
1115393482 14:32879694-32879716 CTTAAAGCCTGGAGCCATGTTGG + Intergenic
1115706257 14:36002059-36002081 ATTAAAGCCAGGATCTTTATTGG + Intergenic
1117002615 14:51386357-51386379 ATCAAGCCCAGAGTCCATGTGGG - Intergenic
1121026734 14:90621488-90621510 ATTATAGGCAGAAGCCACGTGGG + Intronic
1121510378 14:94508596-94508618 ACACAAGCCAGAAACCATGTAGG + Intronic
1124210557 15:27761554-27761576 ATTAAACCTAGAATCAATTTGGG - Intronic
1125180040 15:36872008-36872030 ATTAAAGCCAGAATGGACCTTGG + Intergenic
1129861646 15:78867772-78867794 ATTAAAGCCAGTTTTCATGCAGG + Intronic
1130823573 15:87520246-87520268 ATTAAAGCCAGAAGCGATCAAGG - Intergenic
1132064333 15:98718271-98718293 ATTTTTCCCAGAATCCATGTGGG + Intronic
1133322386 16:4922364-4922386 ATAAAAGCCAGAAGCCAGCTGGG + Intronic
1133449369 16:5890838-5890860 ATTCAAGCCAGACACAATGTTGG - Intergenic
1134427835 16:14169100-14169122 ATTAATGGCAGAATCCAAGTGGG - Intronic
1135518464 16:23155170-23155192 ATTAAAGGCAGAAACAATGCAGG - Intergenic
1138898086 16:61233877-61233899 ACTGAAGCCAGAATCCATGTGGG + Intergenic
1141582149 16:85007070-85007092 ATCAAACCCAGACTCCATATGGG - Intronic
1142524288 17:528056-528078 TTTAGAGCCATAATCCATCTGGG + Intronic
1143303811 17:5930262-5930284 ATTCAGGCCAGATTCCATCTTGG + Intronic
1151885712 17:76922279-76922301 ACTAGACCCAGATTCCATGTGGG + Intronic
1152588289 17:81198830-81198852 CTTAAAGCCAAAAACCATGATGG + Intronic
1152770314 17:82163566-82163588 AAGAAAGCAAGAATCCTTGTAGG + Intronic
1153156108 18:2150812-2150834 AATAAAAACAGAATGCATGTTGG - Intergenic
1153268162 18:3292426-3292448 ATTAAATCCAGAAAGCATCTAGG + Intergenic
1156755654 18:40521516-40521538 ATTAAACCCAGCATACATTTAGG - Intergenic
1158966554 18:62627192-62627214 CTTAAAGGAAGAATCCATGTGGG - Intergenic
1159369648 18:67514598-67514620 ATTAACGCCATGATCCATGGGGG + Exonic
1164674843 19:30094283-30094305 ATTTCAGTCAGAATCCATGCAGG - Intergenic
1164813249 19:31174917-31174939 ATAAAAGCCAGAATGCATGCAGG - Intergenic
1166416348 19:42596992-42597014 GATAAAGTCAGAATCCATGGGGG + Intronic
1166438554 19:42790096-42790118 GATAAAGTCAGAATCCATGGAGG + Intronic
1166467446 19:43044748-43044770 GATAAAGTCAGAATCCATGGGGG + Intronic
1166473579 19:43100829-43100851 GATAAAGTCAGAATCCATGGAGG + Intronic
1166955822 19:46464190-46464212 ATTAAAGCTGGAATCCATCCTGG + Intergenic
931151063 2:59573938-59573960 ATAAAAGAGAGAATCCATGAAGG - Intergenic
933419699 2:82029858-82029880 ATTAAAGGTAGAATTAATGTAGG - Intergenic
935854755 2:107261830-107261852 ATTAAAGGCAGCTTCCATTTAGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936928691 2:117764282-117764304 ATTGAAGCAAGAAGCAATGTTGG - Intergenic
939654250 2:144803151-144803173 ATGTATGCCAGAATCCATCTGGG - Intergenic
941531930 2:166681205-166681227 ATGAAAGCAAGAGGCCATGTAGG - Intergenic
941809308 2:169739358-169739380 ATTAAATCCAGATTCTTTGTTGG + Intronic
942244620 2:173995802-173995824 CTTAAAGACAAAATCCCTGTGGG - Intergenic
943251860 2:185532671-185532693 ATTTAAGCCAGATTCTATCTTGG - Intergenic
944425525 2:199578222-199578244 ATTAAAGCCATAATTAAGGTGGG - Intergenic
945038316 2:205723257-205723279 ATTAGACCCAAGATCCATGTTGG - Intronic
945520617 2:210822924-210822946 ATAAAAGACAGAATGCATTTTGG - Intergenic
948997676 2:241591834-241591856 ATTAAAAACAGAATCCATAAAGG + Intronic
1170954471 20:20965725-20965747 AGTAAAGCCAGAATCAAGTTAGG + Intergenic
1171358024 20:24565699-24565721 AATAAATCCAGACTCCCTGTGGG + Intronic
1172601374 20:36185859-36185881 ATTAAAGGCACACTGCATGTTGG + Intronic
1174448648 20:50607024-50607046 ATTAAAGCAAGAAAGCAGGTTGG - Intronic
1174966112 20:55217325-55217347 ATTGGAGCAAGAATCCAGGTGGG - Intergenic
1177665299 21:24148871-24148893 AAAATAACCAGAATCCATGTTGG - Intergenic
1178726250 21:35054110-35054132 AGAGAAGCCAGAATTCATGTTGG + Intronic
1182243656 22:28937310-28937332 ACTAAAGCCAGCTTCCATGGGGG - Intronic
949524800 3:4892969-4892991 GTAAAAGCCAGAATCCAGGCTGG + Intergenic
950515305 3:13461034-13461056 ACCAAAGCCAGAAGCCGTGTGGG - Intergenic
955037976 3:55287530-55287552 AGTAAATCCAGAATCCAGGAAGG - Intergenic
956016845 3:64892857-64892879 TTGAATGCCAGAATCCAGGTGGG - Intergenic
956254715 3:67271675-67271697 ATTAAGGCCAGAATGGAGGTGGG + Intergenic
957849996 3:85795506-85795528 TTCAAAGTCAGAATACATGTGGG + Intronic
958106478 3:89080267-89080289 TTTAAAGCCATGAGCCATGTAGG + Intergenic
958122118 3:89304383-89304405 ATTAAAGCCAAAATCCTTACAGG + Intronic
958570729 3:95878816-95878838 ATTTAATCCATAAGCCATGTTGG - Intergenic
958825442 3:99024557-99024579 AGTAAAACCAGATTCCTTGTTGG - Intergenic
959960277 3:112290235-112290257 ATTAAATTCAGAAAGCATGTAGG - Intronic
962129554 3:132659046-132659068 ACTAAAGCCAGATTCCCGGTGGG + Intronic
965856451 3:173094322-173094344 TTTAAAGCCAAATTCCCTGTTGG + Intronic
966277806 3:178196806-178196828 AGAAAAGCCAGTATCCAAGTTGG + Intergenic
967942464 3:194776782-194776804 ATAAAGGACAGAATCCAGGTAGG + Intergenic
968420012 4:475925-475947 ATAAATTCCAGAATCCATGTGGG + Intronic
971830255 4:31683487-31683509 ATTAACTCCTGAATTCATGTTGG + Intergenic
977713929 4:100159688-100159710 AAAAAACCCAGATTCCATGTTGG - Intergenic
983089032 4:163482301-163482323 ATTGAAGCCAGAAACCACTTGGG + Intergenic
986030512 5:3888928-3888950 ATAAAATGCAGAATCCATCTGGG + Intergenic
986336787 5:6761485-6761507 ATTCCAGCCAGAATCCAAGGAGG - Intergenic
990503455 5:56421257-56421279 AATAAAGCCAGAATGCCTTTGGG + Intergenic
991958306 5:72017408-72017430 ATTAAAGCCAAACCCCATGGGGG + Intergenic
993853768 5:93044998-93045020 ATTTAATCCAGAAGCCCTGTAGG - Intergenic
995122117 5:108547304-108547326 AAGAAAGCCAGAATGGATGTGGG - Intergenic
996157822 5:120124474-120124496 AGTAAATTCAGAATCCATGAAGG + Intergenic
996162925 5:120188694-120188716 ATTAAGACCAAAATCCTTGTAGG - Intergenic
1000995389 5:167953284-167953306 ATTAAAGTGAGACTGCATGTTGG - Intronic
1001891540 5:175343610-175343632 ATTAATGCAAGAATGCATGCAGG + Intergenic
1003128506 6:3375489-3375511 TTTATTGCCAGAATCAATGTGGG + Intronic
1005180340 6:23097012-23097034 ATTAAATCCAGAGACCAAGTTGG - Intergenic
1007564857 6:42842157-42842179 ATTTAAGTCAGAATTTATGTGGG - Intronic
1009593625 6:65707950-65707972 ATTAAAGCCAGTGTCCAACTGGG - Intergenic
1013658112 6:112266410-112266432 ATTCAAGCTAAAATTCATGTCGG - Intergenic
1014623887 6:123702332-123702354 TTTAAACCCAGACTTCATGTTGG - Intergenic
1017357072 6:153521722-153521744 ATAAAAGGCAGAATACATGGGGG + Intergenic
1018960430 6:168443526-168443548 ATTAAAGCCATAACACATTTTGG + Intronic
1020820121 7:12956633-12956655 ATAAAAGGCAGAATCCATAGAGG + Intergenic
1020986445 7:15141054-15141076 ATTAATGCCAGAATCCTAGAAGG - Intergenic
1021335166 7:19391562-19391584 TTTAAAGCCATAATTCATGATGG + Intergenic
1021476978 7:21073281-21073303 TTTAAAGCAAGAGTCCATTTGGG - Intergenic
1021855468 7:24850542-24850564 AACAAAGCCAGCATCCCTGTTGG - Intronic
1022976712 7:35565382-35565404 TTCAAAGCCAGCATCCATGAAGG + Intergenic
1023353937 7:39348757-39348779 ATTAAAAACAGATTCCATGGTGG + Intronic
1024097005 7:45990081-45990103 AATAAAGCCAAAATGCAAGTTGG + Intergenic
1024446205 7:49482681-49482703 ATTGAAGCAATATTCCATGTTGG - Intergenic
1027770216 7:82397159-82397181 ACAAAAGCCAGAATCCTTTTGGG - Intronic
1027796743 7:82704346-82704368 ATGACAGCCAGAATGCATTTTGG + Intergenic
1034229821 7:149514187-149514209 ATAAAATCCAGCATCCCTGTAGG - Intergenic
1037141782 8:15528704-15528726 ATTAAAGAAAGAATCCAAGAGGG - Intronic
1037287135 8:17313308-17313330 ATTAAAGCCATAATGGATGCAGG - Exonic
1037806211 8:22059071-22059093 AATAAAGGCAGAATCCAGCTAGG - Intronic
1039022449 8:33222875-33222897 ATTAAAGCCAGAGTCTAGGCTGG - Intergenic
1040477925 8:47796953-47796975 ACAAAAACCAGAATCCATGAAGG - Intronic
1040542864 8:48375474-48375496 AGTAAAGGCAGAATCAGTGTGGG - Intergenic
1043127364 8:76416419-76416441 ATTGTAGCCAGATTACATGTTGG - Intergenic
1043240197 8:77923762-77923784 AATAAAAACAGAATCAATGTTGG + Intergenic
1043996717 8:86826745-86826767 AGAAAAGACAGAATCCATTTTGG + Intergenic
1044869384 8:96603612-96603634 CTTCAGGCCAGAATGCATGTGGG + Intronic
1047150271 8:122253042-122253064 ATTAAAAGCAGAATCCAAGCTGG + Intergenic
1047728327 8:127703991-127704013 ATTAAAGCCATAGTGCATGGTGG - Intergenic
1047972180 8:130094635-130094657 ATTAAAGTCACAAGCCATGAGGG + Intronic
1047985248 8:130226453-130226475 ATTAAAGACAAAATCCTTGGAGG + Intronic
1048222647 8:132556148-132556170 ATTAAAGCATGAATCAATCTTGG - Intergenic
1048560201 8:135527784-135527806 AGAAAATCCAGAATCCAAGTTGG + Intronic
1049232872 8:141493288-141493310 ATTCATGCCAGACTCCATGCAGG + Intergenic
1049821759 8:144638796-144638818 GAGAAAGCCAGATTCCATGTCGG - Intergenic
1050137922 9:2487557-2487579 ATTAAAGGCAGAAGACCTGTGGG + Intergenic
1052748786 9:32467716-32467738 AGTCAAAACAGAATCCATGTAGG + Intronic
1052832737 9:33229169-33229191 TTTAAAACCAGAATCTATGGTGG + Intronic
1060262089 9:122084674-122084696 TTTAAAGTAAGAATACATGTTGG - Intronic
1187907236 X:24078426-24078448 ATTAAAATCAGAATCTCTGTGGG - Intergenic
1190298548 X:49042929-49042951 AATAAAGCCACAATCCAAGCAGG + Intronic
1193528720 X:82626980-82627002 GTTAAAGCAAAAATCCATGGAGG + Intergenic
1193534058 X:82691168-82691190 ATTAAAGCCTGGGTCCATGGAGG + Intergenic
1194315536 X:92372087-92372109 ATTAAAGCCAGAATCCATGTAGG + Intronic
1194431051 X:93805928-93805950 ATTAAAGGCAGAATCCATAAAGG - Intergenic
1197336508 X:125215562-125215584 ATGAAACCCAGACTCCATGAAGG - Intergenic
1200623584 Y:5483626-5483648 ATTAAAGCCAGAATCCATGTAGG + Intronic
1201950353 Y:19556894-19556916 ATTGATTCCAGAATCCCTGTTGG + Intergenic