ID: 1200624069

View in Genome Browser
Species Human (GRCh38)
Location Y:5490682-5490704
Sequence CCTCCAATTCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200624069_1200624080 13 Left 1200624069 Y:5490682-5490704 CCCTCCTCCTTCTGAATTGGAGG 0: 1
1: 1
2: 0
3: 27
4: 282
Right 1200624080 Y:5490718-5490740 CCTTCCCAGGTGCAGTTGCAGGG 0: 1
1: 1
2: 0
3: 22
4: 222
1200624069_1200624076 0 Left 1200624069 Y:5490682-5490704 CCCTCCTCCTTCTGAATTGGAGG 0: 1
1: 1
2: 0
3: 27
4: 282
Right 1200624076 Y:5490705-5490727 GGTGACAGCCTCGCCTTCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 207
1200624069_1200624084 23 Left 1200624069 Y:5490682-5490704 CCCTCCTCCTTCTGAATTGGAGG 0: 1
1: 1
2: 0
3: 27
4: 282
Right 1200624084 Y:5490728-5490750 TGCAGTTGCAGGGGCCCAGCTGG 0: 2
1: 0
2: 6
3: 41
4: 321
1200624069_1200624078 12 Left 1200624069 Y:5490682-5490704 CCCTCCTCCTTCTGAATTGGAGG 0: 1
1: 1
2: 0
3: 27
4: 282
Right 1200624078 Y:5490717-5490739 GCCTTCCCAGGTGCAGTTGCAGG 0: 1
1: 1
2: 0
3: 38
4: 372
1200624069_1200624081 14 Left 1200624069 Y:5490682-5490704 CCCTCCTCCTTCTGAATTGGAGG 0: 1
1: 1
2: 0
3: 27
4: 282
Right 1200624081 Y:5490719-5490741 CTTCCCAGGTGCAGTTGCAGGGG 0: 1
1: 1
2: 2
3: 21
4: 263
1200624069_1200624085 24 Left 1200624069 Y:5490682-5490704 CCCTCCTCCTTCTGAATTGGAGG 0: 1
1: 1
2: 0
3: 27
4: 282
Right 1200624085 Y:5490729-5490751 GCAGTTGCAGGGGCCCAGCTGGG 0: 2
1: 0
2: 2
3: 37
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200624069 Original CRISPR CCTCCAATTCAGAAGGAGGA GGG (reversed) Intronic
901714012 1:11138653-11138675 CTTCCTTTTAAGAAGGAGGAAGG + Intronic
902847836 1:19126231-19126253 CCTCCAATTTACAAAGAGGCAGG + Intronic
903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG + Intronic
905006870 1:34716894-34716916 CCTCCATCTCAGAGAGAGGAAGG + Intronic
905398441 1:37683756-37683778 CATCCAATTCAGAGGAAGCAGGG + Intronic
906132593 1:43469395-43469417 CCACCAATGCAGAAGGGGCAGGG + Intergenic
906931802 1:50177405-50177427 CCTCCAATTAAGAGGGCAGATGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
910986982 1:93014769-93014791 CCACCAAGCCAGAAGGAAGAAGG + Intergenic
911407619 1:97462545-97462567 CCTGAATTTCAAAAGGAGGAGGG - Intronic
911497794 1:98651399-98651421 CCTCCAACTCAGAAAGGGGCGGG + Intergenic
912062288 1:105687511-105687533 CCTCAAACTCAGAAGCAGGTGGG + Intergenic
914392888 1:147237539-147237561 CTGCCAACTCAGAAGGAGGCAGG + Intronic
915828867 1:159106235-159106257 CCACCAACTCAGAAGCAGGCAGG + Intronic
916585543 1:166146684-166146706 GCTCAAATTCAGAAGGCAGAGGG + Intronic
916610947 1:166390936-166390958 CCTCCCACTCAGAAGCAGGAGGG + Intergenic
917676853 1:177327194-177327216 CCTCTAATTCAAAAGGAAGTTGG + Intergenic
920500576 1:206482593-206482615 CCTCCCATCAAGGAGGAGGATGG + Intronic
922163893 1:223098770-223098792 TTTCCCATTCAGAAGGAAGAGGG + Intergenic
922435046 1:225596505-225596527 CTTCTGATTAAGAAGGAGGAAGG + Intronic
922491092 1:226017337-226017359 CATACAATTCAGAAGCAGGCTGG - Intergenic
922937946 1:229435161-229435183 CCTCCAATTTATTGGGAGGAAGG - Intergenic
1062868100 10:874351-874373 ACTCCAATTAAGAAAAAGGAAGG + Intronic
1063056240 10:2507453-2507475 CCTCCCCTTCAGAGGGATGATGG - Intergenic
1063564294 10:7159184-7159206 CCAACAATTCAGAAGGATTATGG + Exonic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1067345352 10:45434165-45434187 CCTCCAATTGAGACGGGGCAGGG - Intronic
1067432548 10:46253507-46253529 CCTCCCCTTCAGCAGCAGGAGGG + Intergenic
1067440711 10:46307940-46307962 CCTCCCCTTCAGCAGCAGGAGGG - Intronic
1068213579 10:53953048-53953070 CCTCCAACTCAGAAGTGGGTGGG + Intronic
1069561904 10:69436365-69436387 CCGCCAACTCGGAAGGAGGTGGG + Intergenic
1071166830 10:82816741-82816763 GCCCCAACTCAGAAGGAGGTGGG + Intronic
1072573297 10:96677088-96677110 CCTCCAAGCCAGAGTGAGGAAGG + Intronic
1074255679 10:111800063-111800085 CCTCCAACTCAGAAGGTGTCTGG - Intergenic
1074555061 10:114481286-114481308 CCCCCCATTCAGCAGGAGCAGGG + Intronic
1076505244 10:130968367-130968389 CCTTCAATTCAGAATGAGCAAGG - Intergenic
1078345659 11:10545243-10545265 CCACCAACTCAGAAGCAGGTGGG + Intergenic
1078353648 11:10616742-10616764 CCACTAATACAGAAGGAGGAAGG - Intronic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079848012 11:25494737-25494759 CATCCAACACAGAAGAAGGATGG + Intergenic
1080584152 11:33666249-33666271 GCTCCAACTCAGAAGGGGCAGGG + Intronic
1084265473 11:68003398-68003420 CCTCCAATTCTGACGGTGGCAGG + Intronic
1086023433 11:82260509-82260531 TTTCCAATACAGAAGTAGGAAGG - Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1087385098 11:97461242-97461264 CTTCCAACTCAGAAGGTGGTGGG - Intergenic
1089130317 11:116207218-116207240 CCTCCACTGCAGAACGAGCATGG + Intergenic
1090156213 11:124441170-124441192 CCTCCTATTCTCAAGAAGGAAGG - Intergenic
1094687637 12:32734458-32734480 CATGCAATTCAGAAGCTGGAAGG + Intronic
1095534974 12:43234612-43234634 ACTATAATTCAGAAGAAGGAGGG + Intergenic
1096086080 12:48865862-48865884 CCTCCAACTGAGGAGGAGGCCGG + Exonic
1097550992 12:61068994-61069016 ACTGCAATTCAGTAAGAGGAGGG - Intergenic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1098367225 12:69717114-69717136 CCACCAATTCTCAATGAGGATGG + Intergenic
1099557464 12:84128358-84128380 CCTCCAATTCAGAAAAGGGCGGG - Intergenic
1100821974 12:98439903-98439925 CCTCCAGCTGAAAAGGAGGAAGG - Intergenic
1100847739 12:98678406-98678428 GCCCCAATTCAGAAGGGGTAGGG - Intronic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1102290222 12:111693124-111693146 CCGCCAAATCCCAAGGAGGAAGG - Intronic
1103024714 12:117564114-117564136 GCTCCATTCCCGAAGGAGGAAGG + Intronic
1104575587 12:129963317-129963339 TGTCTAATTCAGAAGCAGGAGGG - Intergenic
1105484311 13:20811794-20811816 CCTACAATACAGAAGGATGGGGG + Intronic
1106037997 13:26062689-26062711 GCCCCAAATCAGAAGGAGCAGGG - Intergenic
1107969002 13:45623196-45623218 TCTCCACATCAGGAGGAGGAGGG - Intergenic
1109224918 13:59681748-59681770 TCTCTAATTCACAATGAGGAAGG + Intronic
1109855220 13:68118416-68118438 CATCCAATTAAAAAGGTGGAAGG - Intergenic
1110342815 13:74413396-74413418 CTGCCAATTCAGAAGGGGGCAGG - Intergenic
1111800622 13:92975375-92975397 GCTCCAACTCAGAAGGGGCAGGG + Intergenic
1112953499 13:105031584-105031606 CCTCCAATGCAACAGAAGGAGGG - Intergenic
1113138300 13:107117938-107117960 CCTCAAATCCAGAAGACGGATGG - Intergenic
1113199418 13:107849696-107849718 CCTCCAATTGAGAGTGAGTAGGG - Intronic
1114349740 14:21836404-21836426 GCTCCAACTCAGAAGGGGCAGGG + Intergenic
1116043966 14:39720326-39720348 CTTCCAATTGAGATTGAGGATGG - Intergenic
1116083496 14:40204987-40205009 CCTCCAACTCAGAAGGGGGCGGG + Intergenic
1116257108 14:42570920-42570942 ACTCCAACTCAGAAGGGGCAGGG - Intergenic
1117662884 14:58026715-58026737 CCTAAAATTGAGAATGAGGAGGG - Intronic
1117898402 14:60510058-60510080 ACTCCAATTCAGCAGGAGTTGGG + Intronic
1119257294 14:73209193-73209215 CCACCAACTCAGAAGGGGGCAGG + Intronic
1120636441 14:86957472-86957494 CATCCAATTCAGAATGAAAAGGG - Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121973980 14:98385593-98385615 CCACCAACTCAGAAGGAGCAGGG - Intergenic
1122299303 14:100722986-100723008 CCTCCAAGAGAGAAGGAGGGTGG - Intergenic
1126474149 15:49048384-49048406 CTTTCAATTGTGAAGGAGGACGG - Intergenic
1126972130 15:54127832-54127854 GCTCCAGTTCCCAAGGAGGAAGG - Intronic
1127279617 15:57477864-57477886 TCTCCAGTTCAGCAGCAGGAGGG - Intronic
1127982221 15:64043798-64043820 GCTCCAAGTCACAAAGAGGAGGG - Intronic
1129070134 15:72944051-72944073 GTTCCAATTCAGAAGAAAGAGGG + Intergenic
1130029081 15:80295506-80295528 CCTGCAACTCAGAAGGGGCAGGG + Intergenic
1131368933 15:91863634-91863656 CCTACATTTCAGGAGGAGGTTGG - Intronic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1132205588 15:99984118-99984140 CCGCGAATTCAGAGGAAGGAGGG - Intronic
1132355423 15:101168039-101168061 CTTCCTCTTCAGGAGGAGGAGGG + Intergenic
1132391388 15:101441198-101441220 CCTCGAAGTCAGCAGAAGGAAGG - Intronic
1133304666 16:4801664-4801686 CCTCCAAGTCAGCGGGGGGAAGG + Intronic
1133331730 16:4979040-4979062 TCTCCAAGTCAGATGCAGGAAGG + Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1136866500 16:33761578-33761600 TCTACAAGTCAGAAGGAGAAGGG - Intergenic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1138272103 16:55702702-55702724 CCACCAAATCAGAGAGAGGATGG + Intronic
1139625974 16:68188428-68188450 CTGCCAATTCAGAAGGTGGCGGG + Intronic
1140103372 16:71938033-71938055 CCTCCAACTCAGAAGGGGGCAGG - Intronic
1140817929 16:78637913-78637935 CCCCCAACTCAGAGGAAGGACGG - Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141920047 16:87129577-87129599 CCTCCAAGTCAGAATCAGGAAGG - Intronic
1143435510 17:6921725-6921747 CCGCCTTTTCAGGAGGAGGAAGG + Intronic
1143643572 17:8214475-8214497 CCCCCATTTCAGAAGGTGGAAGG - Intergenic
1144478915 17:15612875-15612897 GCTCCAACTCTGCAGGAGGAAGG + Intronic
1144533187 17:16060112-16060134 CCTCCCCTTCAGGATGAGGAAGG + Intronic
1144919390 17:18750852-18750874 GCTCCAACTCTGCAGGAGGAAGG - Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1149160523 17:53687267-53687289 CCACCAACTCAGAAGGGGCAGGG + Intergenic
1150443239 17:65208793-65208815 CCATCAATTCAAAAGGGGGATGG + Intronic
1150569054 17:66369753-66369775 CAGCCAACTCAGATGGAGGATGG - Intronic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1152033900 17:77859943-77859965 CCAACAAGACAGAAGGAGGAAGG - Intergenic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1152592802 17:81222175-81222197 CCTCCAAGCCAGAAGAAGGGAGG + Intronic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1153133195 18:1881565-1881587 CCTCCAATTCAAAAGCAGAGTGG + Intergenic
1153428090 18:4988061-4988083 CCACCAACTTGGAAGGAGGAGGG + Intergenic
1154217936 18:12429167-12429189 CCTCCAGCTCAGAAGGGGGAAGG - Intronic
1156410762 18:36826498-36826520 CATCCAATTGAAAAGGAAGAAGG - Intronic
1156690877 18:39705404-39705426 CCTGCATTTCAAAAGCAGGAAGG + Intergenic
1157078540 18:44495707-44495729 CCAGCCATTCTGAAGGAGGAAGG - Intergenic
1157538214 18:48476873-48476895 ACTCCAATTCAGGAGGATGAGGG + Intergenic
1158482660 18:57835693-57835715 CCCCAAGTTCAGCAGGAGGATGG - Intergenic
1158632888 18:59131802-59131824 TCCCCAATTCAGAAGAAGTAGGG - Intergenic
1159010491 18:63054769-63054791 GCTCCAGTTGAGAAGGTGGAAGG - Intergenic
1159604184 18:70457951-70457973 CCTGCAACTCAGAAGGAAGGAGG + Intergenic
1159774394 18:72586098-72586120 CCTCCAACTCAGAAGGGGTGGGG + Intronic
1165022496 19:32935987-32936009 CCACCAACTCAGAAGGGGCAGGG - Intronic
1165800098 19:38544015-38544037 CAGCCAATCCAGAAAGAGGATGG - Intronic
1167311566 19:48740355-48740377 ACTCCGAGTCAGAGGGAGGAGGG + Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168303327 19:55419513-55419535 CCACCAATTCAGAAGGGGCAGGG - Intergenic
1168364043 19:55769573-55769595 CTTTTAATTCAGAAGGAGAAAGG + Intronic
927758069 2:25724719-25724741 CCTCCAATTCTGATGGAGTCTGG + Intergenic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
929903329 2:46024651-46024673 CCTGGACTTCAGAAGGAGGGTGG + Intronic
930711654 2:54556149-54556171 CCTCCAGTTCAGAAGTGGGGAGG - Intronic
931282290 2:60804793-60804815 CTTCCAATTCAGAAGTGGGCAGG + Intergenic
932644766 2:73488549-73488571 CCTCCAACTCAGAAGGGAGTGGG + Intronic
932749424 2:74361975-74361997 CCTCCAATTCTGGAGGAGAGGGG + Intronic
933042468 2:77487176-77487198 CCACCAACTCAGAAGGGGGCGGG - Intronic
934039511 2:88116296-88116318 CCTCCAGTTCAGAAGGGAAAGGG - Intergenic
934635188 2:95980161-95980183 TCTACAAGTCAGAAGGAGAAGGG - Intronic
934798443 2:97125076-97125098 TCTACAAGTCAGAAGGAGAAGGG + Intronic
934834985 2:97578419-97578441 TCTACAAGTCAGAAGGAGAAGGG - Intronic
935518903 2:104078981-104079003 ACTTCAACTCAGAAGGAGCAGGG + Intergenic
936232137 2:110712287-110712309 CCTCCTAGTGAGAAGGGGGAAGG - Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
938732690 2:134158649-134158671 CCACCAATTCGGAAGGGGGAGGG + Intronic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
942054783 2:172172510-172172532 TCTCCATTTAGGAAGGAGGAGGG + Intergenic
942282595 2:174381568-174381590 GCTCCAACTCAGGAGGTGGATGG + Intronic
942367084 2:175239208-175239230 CCTACATTTCAGAATGTGGATGG - Intergenic
942495830 2:176539049-176539071 CCTCTGATTCTGAAGGAGGGTGG - Intergenic
944022870 2:195126352-195126374 CTTCCAACTCAGAAGCAGAAGGG + Intergenic
944586461 2:201178012-201178034 GCTCCAACTCAGAAGGTGGGGGG - Intergenic
944920212 2:204404801-204404823 CCTCCAATGCACAAGGCAGACGG - Intergenic
946431551 2:219629296-219629318 CCTCCCATCCAGGAGGAGGGGGG + Exonic
947351898 2:229255129-229255151 CATCCAACTCAGATGGATGATGG + Intronic
947542415 2:230988134-230988156 CTTCCAAGCCAGCAGGAGGATGG - Intergenic
947709008 2:232299539-232299561 CCTCTGAATCAGGAGGAGGAGGG - Intronic
947751100 2:232532898-232532920 GCTGCAACTCAGAAGGAAGAAGG + Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1170139541 20:13111957-13111979 CCACCACTTCAGAAGGACAAGGG + Intronic
1171113832 20:22507580-22507602 TCTCCTATTCAGAAAGAGTATGG - Intergenic
1172134109 20:32675695-32675717 CCTCCATTTTAGAAGGGGTAAGG + Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1175064300 20:56272357-56272379 CCACCAACTCAGAAGGGGCAGGG - Intergenic
1176059638 20:63166854-63166876 CCTTCAGTTCAGGAGGAGAAGGG + Intergenic
1177235006 21:18377388-18377410 CATCAAACTCAGAAGGGGGAAGG + Intronic
1182775788 22:32830067-32830089 CCGACATTTCAGGAGGAGGAAGG + Intronic
1183443680 22:37838605-37838627 CCACCAAGACAGAGGGAGGAAGG + Intronic
1184081670 22:42225745-42225767 CCCACAAGTCAGAAGCAGGAGGG + Intronic
1184544229 22:45155342-45155364 CCCCTAATTCAGGAGGGGGAAGG - Intergenic
1184730866 22:46370209-46370231 GCTCCAAAACAGATGGAGGACGG + Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950499307 3:13353723-13353745 ACTGCAAATCAGAAGGAGGGAGG - Intronic
952363974 3:32658768-32658790 ACTCCAGGTCAGAAGGAGGCTGG - Intergenic
952684163 3:36130513-36130535 CCTCAAATTCAAAATGAGAAAGG + Intergenic
953033453 3:39192367-39192389 CGTCCATTTCAGAAGGAGAGGGG + Intronic
953548499 3:43882824-43882846 GCTCCAATTCACATGAAGGAAGG + Intergenic
953602944 3:44386448-44386470 CTACCAATTCAGTAGGAGGTGGG - Intronic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
958161334 3:89819196-89819218 CCACCAACTCAGTAGGGGGAGGG + Intergenic
958444727 3:94201573-94201595 CCTCCAAGACAGAAGGAGTAAGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959037354 3:101383411-101383433 CCTCCAACTTGGAAGGAGGGTGG - Intronic
960786725 3:121380906-121380928 CCAACAATTCAGAGGTAGGAGGG + Intronic
962851968 3:139314744-139314766 CCTCCCGTTCGGAGGGAGGAAGG - Intronic
964344742 3:155744602-155744624 CCCATAATTCAGAAGGATGAGGG - Intronic
964791913 3:160460571-160460593 CCACCAACTCAGAAGGAGGGGGG + Intronic
965005561 3:163018829-163018851 TCTCCAACTCAGAAGGGGCAGGG - Intergenic
965229351 3:166029901-166029923 CCACCAACTCAGAAGGAGGCGGG + Intergenic
965367650 3:167820326-167820348 TCTCCAACTCAGAAGGGGGCAGG - Intronic
965727715 3:171736662-171736684 CCTCCAAAAGACAAGGAGGAAGG + Intronic
966086812 3:176078349-176078371 CCTACAATTTTGAAGGAGAAGGG - Intergenic
966437469 3:179904798-179904820 ACCCCAACTCAGAAGGAGAAGGG - Intronic
966932429 3:184684598-184684620 GCAGCCATTCAGAAGGAGGACGG + Intronic
967584378 3:191194110-191194132 CCACCAATTGATAAGGAGCAAGG + Intergenic
967854234 3:194104422-194104444 GCTCCAATTCTGAAAGAGGAAGG + Intergenic
972932767 4:44094039-44094061 CCTCTAGGTCAGAAGGAGGCTGG - Intergenic
973642314 4:52915661-52915683 CCTTCAATTCAATATGAGGAAGG + Intronic
975314119 4:72932335-72932357 CCTCCAATTCTAAGGAAGGATGG + Intergenic
975410170 4:74039470-74039492 CCAACATTTCAGAGGGAGGAAGG - Intergenic
978905180 4:113996924-113996946 CTTCCCACTCAGCAGGAGGACGG - Intergenic
979914125 4:126408733-126408755 GTTCCAATTCTTAAGGAGGATGG - Intergenic
980703025 4:136457268-136457290 CCACCAACTCAGAAGGAGCAGGG - Intergenic
980750162 4:137077346-137077368 CCACCAATTCAGAAGGGGCAGGG + Intergenic
983069819 4:163254567-163254589 CCTCCAACTCAGAAAGGGCAGGG + Intergenic
983838525 4:172424575-172424597 CCTCCAGTTCAGTGGGCGGAGGG + Intronic
984203772 4:176761025-176761047 CCTCCACTTCAGAAGTGGAAGGG + Intronic
985214003 4:187629308-187629330 CCTCAAAGTCAGCAGAAGGAAGG + Intergenic
986822776 5:11486131-11486153 CCTCCATTTCAGAATGACCAGGG + Intronic
988129122 5:27080116-27080138 CCTGCATTTCAGAAGACGGATGG - Intronic
988346258 5:30041777-30041799 CCACCAACTCAGAAACAGGAGGG - Intergenic
988740464 5:34064202-34064224 CCTCCAATTCTAAGGAAGGATGG + Intronic
989209975 5:38848562-38848584 CCTCCCACTCAGAAGAGGGAAGG + Intronic
990299162 5:54433574-54433596 CCCCTAAGTCAGATGGAGGAAGG - Intergenic
990483379 5:56233551-56233573 TCTCCAATTGACAGGGAGGATGG + Intergenic
992944239 5:81794039-81794061 CATCCAGTTCTGAGGGAGGAAGG - Intergenic
993272005 5:85808756-85808778 CCTGAATTTCAAAAGGAGGAGGG + Intergenic
995714890 5:115072661-115072683 ACTCCCATACAGAGGGAGGAGGG + Intergenic
997401329 5:133605374-133605396 CATCCAATTCAGAAAGAAGTGGG + Intronic
997993509 5:138566228-138566250 TCTCCAATTCACAAGGAGAGAGG + Intronic
999911428 5:156205089-156205111 CCTCCCACTCTGATGGAGGAAGG - Intronic
1000835966 5:166154332-166154354 CCTCCCATTCAGAGGGAGTAGGG + Intergenic
1002661475 5:180793359-180793381 CCTCCAGGTGGGAAGGAGGAGGG + Intronic
1003736571 6:8884048-8884070 CCTGCATCTCAGAAGAAGGATGG - Intergenic
1003747305 6:9017133-9017155 CCTCAAAATCAGGAGGAGGATGG - Intergenic
1003801878 6:9679074-9679096 CATCTAGTTCTGAAGGAGGAAGG - Intronic
1008231489 6:48989660-48989682 CTACCAACTCAGAAGGAGGTGGG - Intergenic
1010147232 6:72684157-72684179 CTTCCAATTCCGAATGAGTATGG + Intronic
1013702622 6:112791967-112791989 CCTCAAATTTAGCAGAAGGAAGG - Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1017437715 6:154432973-154432995 CCTCAACATCAGTAGGAGGAAGG + Intronic
1018486908 6:164249843-164249865 CCTGCATTTGAAAAGGAGGATGG - Intergenic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1019132522 6:169887812-169887834 CCTCCTATTCAGCCGGAGGAAGG - Intergenic
1024946426 7:54812308-54812330 TCTCCTATTCAGTAGGAGGGTGG - Intergenic
1027231364 7:76274554-76274576 GCTCAAATTCAGAAGATGGAAGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028136643 7:87230120-87230142 CCACCAATTCAGAAAGGGGCTGG - Intergenic
1028401750 7:90432547-90432569 CCTACAATTCAGAAGGAATTGGG + Intronic
1028577800 7:92371560-92371582 TCTCCAATACAGAAGAATGAAGG + Exonic
1030243686 7:107359061-107359083 CCTCCAACTCAGAAGTGGGTGGG - Intronic
1030804689 7:113901311-113901333 AGTCCAATTTAGAAGGGGGATGG - Intronic
1031430475 7:121662339-121662361 TCTCCATTTCAGAAGCATGATGG + Intergenic
1031938823 7:127765707-127765729 CCTCCAATTAAGAAAGATAAAGG + Intronic
1032420643 7:131776285-131776307 CCACCATTGCAGTAGGAGGAGGG + Intergenic
1032564519 7:132928123-132928145 CTTCCTAGTCAGAATGAGGAAGG + Intronic
1033431469 7:141293335-141293357 CCTGCAATTCACTAGGAGTATGG + Intronic
1033769023 7:144527711-144527733 ACTTCAATTCATAATGAGGAGGG - Intronic
1036264061 8:7261056-7261078 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036265357 8:7268678-7268700 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036266658 8:7276300-7276322 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036267964 8:7283922-7283944 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036269268 8:7291544-7291566 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036297325 8:7547880-7547902 CTTGCAGTTCAGATGGAGGAAGG + Intergenic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036316101 8:7719595-7719617 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036317410 8:7727243-7727265 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036318718 8:7734891-7734913 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036320025 8:7742538-7742560 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036321334 8:7750186-7750208 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036322643 8:7757834-7757856 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036323949 8:7765483-7765505 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036325254 8:7773139-7773161 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036353391 8:8026470-8026492 CTTGCAGTTCAGATGGAGGAAGG + Intergenic
1036700323 8:11008947-11008969 CTTCCAACTCAGAAAGAGCAAGG + Intronic
1039218823 8:35305183-35305205 ACTCCAAGTGAGAAGTAGGATGG + Intronic
1041205609 8:55495370-55495392 CCACCCACTCAGAAGGAGCAGGG + Intronic
1041778490 8:61551300-61551322 GCTCCAACTCTGAAAGAGGATGG - Intronic
1043737865 8:83769329-83769351 CCTCAAACTCGGAAGGAGGCAGG + Intergenic
1044852597 8:96443831-96443853 CCATCATTTGAGAAGGAGGAAGG - Intergenic
1046678154 8:117135459-117135481 CCTACAATTCAGAAGCAACAAGG - Intronic
1046766109 8:118072048-118072070 CCACCAAATCAAAAAGAGGAAGG + Intronic
1049021650 8:139961359-139961381 ACTCCAATTCAGAAGGGGTGGGG - Intronic
1049575445 8:143387721-143387743 TCTCCAAGTCAGCAGGAGGAAGG + Intergenic
1055341358 9:75287496-75287518 CCTACAAGCCAGAAGGGGGAGGG - Intergenic
1059104669 9:111501301-111501323 CCACCAACTCAGAAGGGGGTGGG - Intergenic
1059212684 9:112528486-112528508 ACTCCAATTGTGAGGGAGGAAGG - Intronic
1059401105 9:114071114-114071136 CCACCAATTCAGAAGGGGCAGGG - Intronic
1059566225 9:115385540-115385562 CCCCCAACTCAAAAGGAGCAAGG - Intronic
1060938700 9:127530873-127530895 CCACCTATTCAGAAGTGGGAAGG + Intronic
1061574143 9:131495642-131495664 CCTGCAACTCAGGAGCAGGAAGG + Intronic
1062203547 9:135321871-135321893 CTTCCAAGTCAGAGGGAAGATGG - Intergenic
1185935869 X:4256964-4256986 CCACCAACTCGGAGGGAGGAAGG - Intergenic
1186077900 X:5900441-5900463 CCTCCAAATCTGTAGGGGGAGGG - Intronic
1186223819 X:7376221-7376243 CCTCTAACTCAGAAGGGGGTGGG + Intergenic
1192553327 X:72070681-72070703 CCACCAAGACAGAGGGAGGAGGG - Intergenic
1193385875 X:80871327-80871349 CCTCCAGTTCAGAAGGATCATGG + Intergenic
1194212072 X:91082071-91082093 CCCCCAACTCAGAAGGGGGCAGG - Intergenic
1194316020 X:92379108-92379130 CCTCCAATTCAGAAGGAGGTGGG - Intronic
1194379208 X:93174489-93174511 GCCCCAATTCAGAAGGGGCAGGG - Intergenic
1194420495 X:93667280-93667302 CCTCCAGCTCAGAAGTAGGAAGG - Intergenic
1195196810 X:102505098-102505120 CTTCCAATTCTGAAAGAAGATGG - Intergenic
1195217617 X:102715740-102715762 TCTCCAACCCAGAAGGAGAATGG - Exonic
1195232394 X:102863144-102863166 GCTACAATTCACAAGGAAGATGG - Intergenic
1195248261 X:103016936-103016958 CCTTCAATTCAGACAGAGGCTGG + Intergenic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic
1202585494 Y:26420996-26421018 TCTACAAGTCAGAAGGAGAAGGG + Intergenic