ID: 1200624820

View in Genome Browser
Species Human (GRCh38)
Location Y:5498285-5498307
Sequence GTTCAGCCTATTCCCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 2, 1: 9, 2: 19, 3: 33, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200624820 Original CRISPR GTTCAGCCTATTCCCAGGAA TGG Intronic
906009348 1:42509200-42509222 GTTCAGCCTATGTCTAGGGATGG - Intronic
906147261 1:43567471-43567493 GTACAGCCAGGTCCCAGGAAAGG + Intronic
906213395 1:44024687-44024709 CTTCAGCCTTTCCCCAGGAGGGG + Intronic
911449607 1:98046270-98046292 GCTCAGCCCATCCCCAGGCAGGG - Intergenic
911798082 1:102099336-102099358 GTTCAGCCTATGCCCAGGAATGG - Intergenic
914511012 1:148332032-148332054 GCCTGGCCTATTCCCAGGAATGG - Intergenic
915246539 1:154559386-154559408 GTTTTTCCTATTCCCAGGGAGGG + Intergenic
915875972 1:159612560-159612582 TTCCAGCCTATTCACAGGGATGG - Intergenic
917455691 1:175183749-175183771 GCACAGACTAATCCCAGGAATGG + Intronic
920305239 1:205014370-205014392 TTTCAGCCTTTTCCCAGGTTAGG - Intronic
920640192 1:207744280-207744302 GTTCAGTCTATGCCCAGGGATGG + Intergenic
923451253 1:234119544-234119566 GCTCAGCCTATGACCAAGAAAGG - Intronic
924126226 1:240854922-240854944 GTTCTGACTATTTCCAGGCATGG + Intronic
924770322 1:247074326-247074348 GGTCAGCCTGTTCACAGGAGAGG - Intronic
1062974191 10:1671617-1671639 TGTCAGCCCATTCCCAGGACTGG - Intronic
1065427262 10:25618728-25618750 GCTTGGCCTATGCCCAGGAATGG + Intergenic
1066341966 10:34543505-34543527 GTGCAACCTGTTCCCAGGCAAGG + Intronic
1067274458 10:44821629-44821651 GTGAAGCCCATTCCCATGAACGG - Intergenic
1068025445 10:51637408-51637430 TTTCAGCATATACCCAGTAATGG - Intronic
1068479942 10:57577895-57577917 GTTCAGCCTATGCACAGGGACGG - Intergenic
1070569974 10:77633482-77633504 GTGCAGCCAATCCCCAGGACAGG + Intronic
1070731944 10:78835309-78835331 GTTCAGAACATTCCCAGGAAAGG + Intergenic
1071346867 10:84701629-84701651 GCTCAGCTTCTTGCCAGGAAGGG - Intergenic
1071979218 10:90986897-90986919 ATGCAGGCTATTCCCAGGGAAGG - Intergenic
1072120536 10:92402058-92402080 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1072279457 10:93852643-93852665 ATTTGGCCTATGCCCAGGAATGG - Intergenic
1073235406 10:102010880-102010902 TCTCAGCCTGTTCTCAGGAAGGG - Intronic
1073486542 10:103822610-103822632 GGGCAGCCTCTTCCCAGGGAGGG + Intronic
1076823634 10:132955998-132956020 GTTCAGCCTACGCCCCGGAATGG - Intergenic
1077348143 11:2073820-2073842 GTGTCGCCTACTCCCAGGAATGG - Intergenic
1077523403 11:3049692-3049714 GGGCAGCCTGTGCCCAGGAAGGG - Intronic
1077732879 11:4752843-4752865 GATCAGGGTATTCCCAGAAAGGG + Intronic
1077974215 11:7230404-7230426 TTTCAGACTTTTCCCAGGAATGG + Intergenic
1078661612 11:13292023-13292045 GTTCACTCCATTCCTAGGAAAGG - Intronic
1079541900 11:21586647-21586669 CTTCTGCCTATTCCCAGGGAAGG + Intergenic
1080028808 11:27638978-27639000 GTTCAGCCTACGCCCAGGAATGG + Intergenic
1080097497 11:28426425-28426447 TTTCAGTATATACCCAGGAATGG + Intergenic
1080295811 11:30725980-30726002 GTGCAACTTATTCCCAAGAAAGG + Intergenic
1082258013 11:50053756-50053778 GTGCAGCCAACTCCCAGCAAAGG + Intergenic
1083013400 11:59425628-59425650 CTTCAGCTTATGCCCAAGAATGG + Intergenic
1083253125 11:61481254-61481276 GTGCAGCCAATTCCCAGGGGAGG + Intronic
1083769721 11:64859882-64859904 GAGCAGCCTATTGCCAGGCAGGG - Intronic
1085072368 11:73558936-73558958 GTTCAGTGTATACCTAGGAATGG - Intronic
1086621315 11:88889312-88889334 GTTCAGCCTACACCCAGGGATGG + Intronic
1087673249 11:101129598-101129620 GTACAGCCCATTCCCAGGAAGGG + Exonic
1088053794 11:105551532-105551554 TTTCAGCCTATGCCCAGGAATGG + Intergenic
1089582250 11:119488797-119488819 GTACAGCCTGTCCGCAGGAATGG + Intergenic
1089737035 11:120556651-120556673 GTTAAGCCCATTCCCAAGACAGG - Intronic
1092750049 12:11710315-11710337 GTTCTGCCTGTTACAAGGAAAGG + Intronic
1094014594 12:25849305-25849327 GTTCAGCCTTTTTGCATGAAGGG + Intergenic
1094091887 12:26659848-26659870 TTCCAGCCTATTCACAGAAAAGG - Intronic
1095268768 12:40191560-40191582 GTTCAGTCTACACCAAGGAATGG - Intergenic
1095572817 12:43701758-43701780 CTTCAGCCTATGCCCAGGATGGG + Intergenic
1095735939 12:45556094-45556116 GTACAGCCTACTAGCAGGAAGGG + Intergenic
1095887617 12:47205555-47205577 GTTCAGCCTATACCCAGGAATGG + Intronic
1096492147 12:52018798-52018820 GTCCTCCCTAGTCCCAGGAAGGG + Intergenic
1098208460 12:68137166-68137188 GTCCAACTTATTCCCAGGAATGG + Intergenic
1098241146 12:68468333-68468355 GTGCAGCTTATTCCCAGCGAAGG + Intergenic
1099431406 12:82590807-82590829 TTTCAGTCTATACCCAGTAATGG - Intergenic
1102192963 12:111002762-111002784 GTTCAGCCTATGCCCAGGAATGG + Intergenic
1103359213 12:120343724-120343746 GTTCATCCTCTTTCCTGGAATGG + Intronic
1103539643 12:121657110-121657132 GTTCAGCTTAAGCCCAGGAATGG - Intronic
1106439601 13:29754321-29754343 GTTCAGCCTATACCCAGGAATGG + Intergenic
1109173488 13:59125654-59125676 GATAATACTATTCCCAGGAAGGG + Intergenic
1109300875 13:60588891-60588913 GTTCGGCCTACACCCAGGAATGG - Intergenic
1109310861 13:60691543-60691565 TTTCAGTCTGTTCCTAGGAAAGG + Intergenic
1110953180 13:81520565-81520587 GTTCAGCCTATGCCCAGGGATGG - Intergenic
1112037803 13:95513965-95513987 TTCCAGCCTATTACCAGGCATGG + Intronic
1112597265 13:100818881-100818903 GTGCAGCGTATCCCCAGGCATGG + Intergenic
1113018638 13:105857010-105857032 GTTCAGCCTGTGCCCAGGAATGG - Intergenic
1113569366 13:111342996-111343018 GTTGAGCCCCTTCCCAGGGAAGG - Intronic
1115584353 14:34795352-34795374 ATTCTGCCTATTTCCAGAAATGG - Intronic
1118427730 14:65685451-65685473 GTTAACCCTATTACCAGAAAGGG + Intronic
1120105110 14:80485114-80485136 GTTCAGCCCATATCCAGTAATGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1123903721 15:24901552-24901574 ATTGAGCATATTCCCAGGTAAGG - Intronic
1124703980 15:31945682-31945704 AGTCAGCCTATTCTCAGGAGGGG + Intergenic
1125690722 15:41594040-41594062 GTTCAGCCTATGCCCAGGAATGG + Intergenic
1127621306 15:60737268-60737290 CTTCTACCTATTTCCAGGAAAGG + Intronic
1128075404 15:64822572-64822594 GCTCAGCCTCTTCACAGGCAGGG + Exonic
1129634479 15:77300412-77300434 TTTCATTTTATTCCCAGGAAAGG + Intronic
1131157534 15:90084417-90084439 GCTCAGGCTGTTCCCTGGAAGGG - Intronic
1131367460 15:91853143-91853165 GGGCAGGCTGTTCCCAGGAAGGG - Intergenic
1131577906 15:93610672-93610694 GTTTAACCTATGCCTAGGAATGG - Intergenic
1133227791 16:4350829-4350851 GGTCAGCCACTTCCCTGGAAAGG + Intronic
1135602438 16:23794846-23794868 GCTTGGCCTATGCCCAGGAATGG - Intergenic
1135640601 16:24116523-24116545 GTTCCACTTGTTCCCAGGAAGGG - Intronic
1135897825 16:26424877-26424899 TTTCAGTATATTCCCAGTAATGG - Intergenic
1136351782 16:29714492-29714514 GTCCAGCCTACACCCAGGGATGG + Intergenic
1136926673 16:34381226-34381248 CTTCCACCTCTTCCCAGGAAAGG + Intergenic
1136977901 16:35030581-35030603 CTTCCACCTCTTCCCAGGAAAGG - Intergenic
1138041650 16:53677354-53677376 GTTTAGCATTGTCCCAGGAAAGG - Intronic
1139014797 16:62677189-62677211 GTTCAGCCTATGCCCAGGAAGGG - Intergenic
1141521655 16:84584196-84584218 GTTCAGCGCATTCCCCGGACTGG + Intronic
1143398957 17:6628221-6628243 CTTCAGCCTCATCCCAGGATAGG - Exonic
1143466696 17:7141694-7141716 GTTCAGCCCACGCCGAGGAATGG - Intergenic
1144593172 17:16542003-16542025 ATTCAGCCTATGCCCGGGGATGG + Intergenic
1144796902 17:17897873-17897895 GTTCAGCACAGTCCCAGGCAGGG + Intronic
1146352140 17:32103816-32103838 GTTCTCTCTTTTCCCAGGAAAGG + Intergenic
1148072604 17:44916852-44916874 ATTCAGCCTGTGCCCAGGAAAGG - Intronic
1149079825 17:52641875-52641897 CTTAACCCTATGCCCAGGAAAGG + Intergenic
1149369747 17:55981187-55981209 CTTCAGCCTATACCCAGAAATGG - Intergenic
1151425254 17:74026934-74026956 GTCCAGCCTGTTCTCAGGAGGGG + Intergenic
1151863171 17:76781438-76781460 TTCCAGCCTATTCTCAGGGAGGG + Intronic
1153653851 18:7264776-7264798 TTTCAGCCTAGGCTCAGGAAAGG - Intergenic
1155755862 18:29494781-29494803 GTTCAGGCTTTTCACAGGATTGG + Intergenic
1158016413 18:52789779-52789801 GTTCAGCCTACACTCAGGGATGG - Intronic
1158978708 18:62737589-62737611 GTTCAGCCTAGTGGCAGGGAAGG + Intronic
1161640803 19:5421543-5421565 TTTTAACCTATTCTCAGGAAAGG - Intergenic
1161854687 19:6757206-6757228 GTTGAGCCTATTCAAAGGCATGG - Intronic
1164737360 19:30551675-30551697 TTTCAGCATCTTCCCAGGAGTGG - Intronic
1166436949 19:42775196-42775218 TTTGGGCCTATACCCAGGAATGG + Intronic
924958814 2:15077-15099 GCTGAGACTATTTCCAGGAAGGG + Intergenic
925553423 2:5101626-5101648 TTTCAGCATATACCTAGGAATGG - Intergenic
926383456 2:12313903-12313925 GTTCAGCCTAGCCCCAGTGAAGG - Intergenic
928296466 2:30088429-30088451 GTTCAGCCTACACCCAGGAATGG - Intergenic
928901313 2:36320690-36320712 ATTCAACATATGCCCAGGAATGG - Intergenic
929850955 2:45590248-45590270 GTTCAGCGTACGCCTAGGAATGG - Intronic
930221810 2:48753637-48753659 CTTCAGCCTTTTCCAGGGAAGGG + Intronic
930302735 2:49637850-49637872 GTTCAGCCTATGCCCAGGAATGG - Intergenic
931598299 2:63975270-63975292 GTTCACCCTATGCCCAAGAATGG - Intronic
936447595 2:112607914-112607936 GTTCGGCCTATGCCCAGGAATGG - Intergenic
940054653 2:149500765-149500787 GTTTACCCCATTGCCAGGAAGGG + Intergenic
941960330 2:171246895-171246917 GTTCAGCCCATGTCCAGGAATGG + Intergenic
943688077 2:190840613-190840635 TTTCAGGAAATTCCCAGGAAGGG + Intergenic
943984935 2:194606328-194606350 GTTCAGCCTATGCCCAGGGCTGG + Intergenic
946213612 2:218166690-218166712 GGTCAGCCTCTTCCCACAAAAGG + Intronic
946621363 2:221567339-221567361 GTTAATCCTATACCCTGGAAAGG - Intronic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
1168816946 20:744292-744314 GTACAGCATCTCCCCAGGAAGGG + Intergenic
1169947878 20:11008864-11008886 GTTCAGGCGTTTCCCTGGAAAGG + Intergenic
1170509146 20:17058952-17058974 GTTCAGCCTATGCCCAGGAATGG + Intergenic
1170736185 20:19015809-19015831 ATGCAGCCTCATCCCAGGAAAGG - Intergenic
1170932684 20:20782981-20783003 ATTCAGCCCAGTCACAGGAAGGG - Intergenic
1171195391 20:23193603-23193625 GTTCAGCCTGACCCCAGGCAGGG - Intergenic
1174569309 20:51490055-51490077 GTTCTGCCTATTCACAAAAAGGG + Intronic
1174591409 20:51648158-51648180 GCTCAGGCTATACCCAGGCATGG + Intronic
1174742138 20:53025493-53025515 TCTCAGCCTATTTCCAGGAAGGG - Intronic
1175273693 20:57753117-57753139 TTTGAGCCTATACCCAGGAGTGG + Intergenic
1175298316 20:57924798-57924820 GTTGAGTCTCTGCCCAGGAATGG + Intergenic
1175544224 20:59767730-59767752 GTGCAGCCAGTTCCCAGGATGGG + Intronic
1177332517 21:19681659-19681681 GTTCCACCTATGCCCAGGGATGG + Intergenic
1178097556 21:29232248-29232270 GCTCGGTCTATGCCCAGGAAGGG + Intronic
1179901947 21:44398980-44399002 GTGTGGCCTATGCCCAGGAATGG + Intronic
1181446349 22:22978046-22978068 GTTCAGCCTACACCCAGGGATGG + Intergenic
1182096247 22:27627920-27627942 GTTCAGCTCATCCCCTGGAAAGG + Intergenic
1182791606 22:32957734-32957756 GTTAAGCCTAGGCTCAGGAAAGG + Intronic
1183858451 22:40652407-40652429 GTGCAGCCTGTTCCCGGGATGGG + Intergenic
1183865365 22:40700131-40700153 GTTCAGGATATTGTCAGGAATGG - Intergenic
1184441098 22:44516537-44516559 GGCCAGCCTATTCTTAGGAAGGG - Intergenic
949613480 3:5728194-5728216 GTTCGGCCTATGCCCAGGAATGG + Intergenic
949811504 3:8011763-8011785 GTTCGGCCTACATCCAGGAATGG - Intergenic
950004717 3:9684421-9684443 CTCCAGCCTAGTCCCAGAAAGGG - Intronic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
951424911 3:22533044-22533066 TTTCAGTCTATACCCAGTAATGG - Intergenic
953230528 3:41061145-41061167 GTTCATATTATTCCCAGGAAGGG + Intergenic
955494009 3:59512219-59512241 GTTCTGCATGTTCACAGGAAGGG - Intergenic
955814117 3:62823825-62823847 AGTCAGTTTATTCCCAGGAAAGG - Intronic
956520219 3:70095595-70095617 GCTCTGCCAATTGCCAGGAAGGG + Intergenic
957774254 3:84735447-84735469 TTTCAGTATATACCCAGGAATGG - Intergenic
958750208 3:98186578-98186600 GTTCAGCCTATGCCCAGGGATGG - Intronic
964961824 3:162437157-162437179 GTTCAGCCTATGCCCAGGGATGG - Intergenic
964961857 3:162437362-162437384 GTTCAGCCTATGCCCAGGGATGG - Intergenic
966773671 3:183525449-183525471 GTACAGCATATTTCCAGGAATGG - Intronic
967760835 3:193224913-193224935 GTTTGGCCTATGCCCAGGAATGG - Intergenic
967852054 3:194089723-194089745 GTTAAGCCCATTGCCAAGAAAGG + Intergenic
968636828 4:1685021-1685043 CTCCAGCAAATTCCCAGGAAGGG + Intergenic
968759122 4:2432997-2433019 GTCCAGCCTATTCACAGAGAGGG - Intronic
969507611 4:7597881-7597903 GGTCAGCGGATTCCCAGGAAGGG + Intronic
970418780 4:15884933-15884955 TTTGAACCTATTCCCAGGATGGG - Intergenic
971089577 4:23325159-23325181 GGCCAGCCTCTTCTCAGGAAAGG - Intergenic
971968765 4:33594935-33594957 GTTCAGCCTACACCCAGGGATGG + Intergenic
972215954 4:36896915-36896937 GTTCAGCCTATGCCCAGGGATGG + Intergenic
972601520 4:40577070-40577092 TTTCAGCCCACTCCAAGGAATGG + Intronic
974467232 4:62272873-62272895 GGTCAGCCTATTCTTAGGAGAGG - Intergenic
975730394 4:77332286-77332308 GTTCAGCCTACTCCCAGGGATGG - Intronic
977389069 4:96384430-96384452 GTTCAGCTTATGCCCTGGAACGG + Intergenic
978457413 4:108909169-108909191 GTTCAACCTACGCCCAGGAATGG + Intronic
979308188 4:119172793-119172815 GTTTGGCCTATTCCTAGGAAAGG + Intronic
980145677 4:128981237-128981259 GTTCAGCCTATGCCCAGGAATGG - Intronic
980642548 4:135598523-135598545 GTTTTGCCTATGCCCAGGGAAGG + Intergenic
983886488 4:172986058-172986080 GTTCAGGCTACCCCCAGCAATGG + Intronic
984374218 4:178906633-178906655 ATTCAACTTATTCCTAGGAATGG - Intergenic
985286527 4:188341766-188341788 GTGCTGCCTGTTCCTAGGAAAGG - Intergenic
985377458 4:189355990-189356012 GTTCATCCCATTCGCAGGGAGGG - Intergenic
988916178 5:35895514-35895536 GTTCAACCTATTAGGAGGAAAGG - Intergenic
990611690 5:57463849-57463871 CTTAAGCATATTCCCTGGAATGG + Intergenic
992722771 5:79577259-79577281 GTTTGGCCTATGCCCGGGAATGG - Intergenic
995504116 5:112841213-112841235 ATTCAGCCTTTTCCCTGGAAAGG - Exonic
1001130777 5:169061754-169061776 ATCCAGCATTTTCCCAGGAAGGG - Intronic
1001554644 5:172628012-172628034 GTTTGGCCTATGCCCAGGAGAGG + Intergenic
1001917701 5:175575470-175575492 GCTCATCCTATTCCCACAAATGG - Intergenic
1005119388 6:22372991-22373013 GTTCAGTCTATGGCCAGGAATGG + Intergenic
1005181597 6:23113369-23113391 ATTTAGCCTATGCCCAGGGATGG - Intergenic
1005906699 6:30267419-30267441 GTTCACCCTATTACCGGAAATGG - Intergenic
1006521198 6:34572205-34572227 GGTCAGCCTTTTCCCACGACGGG + Intergenic
1006974938 6:38091038-38091060 GTTCAGCCTTTTCTCAGAAGAGG - Intronic
1008955798 6:57214227-57214249 GGTCAGCCTCTTCCCAGCCAGGG + Intronic
1016981302 6:149857180-149857202 GTTCGGCCTATGCCCAGGAATGG - Intronic
1017980507 6:159397300-159397322 GTTCGGCCTACATCCAGGAATGG - Intergenic
1018042945 6:159941140-159941162 CTTCAGGCTCTACCCAGGAAAGG + Intergenic
1018366431 6:163124622-163124644 GTCCAGCATTTCCCCAGGAATGG + Intronic
1020720666 7:11740574-11740596 GGTCAGGCTATATCCAGGAAGGG - Intronic
1023606558 7:41936651-41936673 GTGCAGCCTGTGCCCAGGGAGGG - Intergenic
1023932432 7:44713961-44713983 GTTCAGCCTATGCCCGGGAATGG - Intergenic
1024202370 7:47120353-47120375 GTTCAGTCCATTCCCACGCAAGG + Intergenic
1026906913 7:74068127-74068149 CATCAGACTATTCCCAGGAGGGG + Intronic
1027436547 7:78171002-78171024 GGTCAGCCTCTGCCCAGCAAAGG - Intronic
1029559693 7:101294475-101294497 GTTCCGCCTACACCCAGGAATGG + Intergenic
1030308351 7:108042507-108042529 GTTCAGCCTATTCCTAGACCTGG + Intronic
1030757376 7:113303818-113303840 ATTCAGTATATTCCCAGTAACGG + Intergenic
1032246698 7:130219463-130219485 GCTTGGCCTATGCCCAGGAATGG - Intergenic
1039013526 8:33122043-33122065 GTTCAGCCTACACCTAGGAATGG - Intergenic
1040273087 8:45979946-45979968 TTTCAGCCTATTCGTAGAAAAGG + Intergenic
1041280046 8:56199696-56199718 GTACTGCCTAGTGCCAGGAAGGG - Intronic
1042497627 8:69472473-69472495 TTTCTGCCTTTTCCCTGGAAGGG + Intronic
1043250790 8:78070722-78070744 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1043697304 8:83236410-83236432 GTTGAGTCTTTTCCCAGGATGGG + Intergenic
1043775303 8:84259948-84259970 GTTCACTGTATTCCCTGGAAAGG + Intronic
1045418700 8:101992769-101992791 GTTCAGCCCATGCCCAGGCCTGG + Intronic
1046503548 8:115109937-115109959 TTTCCACATATTCCCAGGAAGGG + Intergenic
1047226354 8:122958340-122958362 TTTCAGCCTTTTCCTAGGACAGG - Intronic
1050580613 9:7051455-7051477 GAGCATCCTATTCCCTGGAAAGG - Intronic
1051219536 9:14833398-14833420 GTTCAGCCTACACCCAGGGATGG + Intronic
1051672574 9:19526351-19526373 CTTAAGCCTATTCCTAGGAGTGG + Intronic
1055017891 9:71638820-71638842 GTACTGCCTTTTCCCAGGCATGG - Intergenic
1057218575 9:93243382-93243404 GTTCAGCCAACTGCCAGGGACGG - Intronic
1058862120 9:109126714-109126736 GTTCCCCCTCTTCACAGGAATGG + Intergenic
1059342126 9:113603221-113603243 GTTCTGTCCATTCCAAGGAAGGG + Intergenic
1060172149 9:121470675-121470697 ATTAAGCCTACGCCCAGGAATGG - Intergenic
1060724128 9:125996066-125996088 GATCAGACTAGCCCCAGGAAAGG - Intergenic
1062309716 9:135929259-135929281 GTTCAGCCTAAGCCCAGGGCTGG - Intergenic
1185592793 X:1288742-1288764 TTTCTACCTCTTCCCAGGAAGGG + Exonic
1186116732 X:6311670-6311692 GTTCAGCCTATGCCCAGGAGTGG + Intergenic
1186380252 X:9050528-9050550 GTTGAGTATATTCCTAGGAATGG - Intronic
1188159522 X:26783194-26783216 GTTCAGCCTATGCCCAGGGATGG - Intergenic
1188894364 X:35648677-35648699 TTTCAGCATATTGCCAGAAAAGG - Intergenic
1189515813 X:41712566-41712588 GTTTGGCCTATGCCCAGTAATGG - Intronic
1190161675 X:48036137-48036159 GATTGGCCCATTCCCAGGAAAGG + Intronic
1190940243 X:55033194-55033216 GTTCTGCCTGTACCCAGAAAAGG + Intergenic
1194316644 X:92384963-92384985 GTTCAGCCTATTCCCAGGAATGG + Intronic
1194341763 X:92714299-92714321 GTTCAGCCTATGCCCAGCCCAGG + Intergenic
1194690014 X:96973031-96973053 GATGAGCCTATTCCCAGACAAGG - Intronic
1194809620 X:98374785-98374807 GGCCAGCCTATTCTCAGGAATGG + Intergenic
1195573207 X:106420046-106420068 GACCACCCTCTTCCCAGGAAAGG + Intergenic
1197111060 X:122775528-122775550 GTTCAGCCTACACCCCGGAATGG - Intergenic
1198560868 X:137848718-137848740 GTGCAGCCTCCTCCCAGGCAAGG - Intergenic
1199788148 X:151124266-151124288 TTTCAGCATATACCCAGTAATGG - Intergenic
1200624820 Y:5498285-5498307 GTTCAGCCTATTCCCAGGAATGG + Intronic
1200650110 Y:5830993-5831015 GTTCAGCCTATGCCCAGCCCAGG + Intergenic
1201480769 Y:14437346-14437368 GTTCAGCCTCTGCCCAGAAGTGG - Intergenic