ID: 1200632253

View in Genome Browser
Species Human (GRCh38)
Location Y:5603768-5603790
Sequence GGCACGCATGATAGTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200632253 Original CRISPR GGCACGCATGATAGTGAGAC AGG (reversed) Intronic
903275959 1:22222136-22222158 GGCATGCATGAAGGTGAGAAAGG - Intergenic
908741511 1:67333699-67333721 GGCAGGCCTGATAGTGACACTGG + Intronic
911087800 1:93993674-93993696 GGGAAGCATGAAAGTGTGACTGG + Intronic
924749507 1:246872692-246872714 AGCACCCATGATAGTGCGATGGG - Intronic
1064064081 10:12165817-12165839 GGCAGGCAGGATAGTGACAGTGG + Exonic
1064318006 10:14276212-14276234 GGCAGGCATGACAGTGAGGCAGG - Intronic
1070956742 10:80468896-80468918 GGCAAGCATGACAGTGTGGCTGG - Intronic
1073129997 10:101182088-101182110 GCTAAGCATGGTAGTGAGACAGG + Intergenic
1080802264 11:35619212-35619234 GGCGCGCCAGATAGTAAGACAGG - Exonic
1081267956 11:41050107-41050129 GGGAGGCATCATAGTGAGAAGGG + Intronic
1081469659 11:43358440-43358462 GGCTCGCATTATAGTGCTACTGG + Intergenic
1081966358 11:47172521-47172543 GGCACCCAGCAGAGTGAGACAGG + Intronic
1086526200 11:87728980-87729002 GGCAGCCATGATAGTGATATTGG + Intergenic
1088624909 11:111723079-111723101 GGCACACATGATAGTAAGGGAGG - Intronic
1089298411 11:117483258-117483280 GGTACGCATGACAATGAGACAGG + Intronic
1091075204 11:132609020-132609042 GGCCTGCATCATAGTAAGACAGG - Intronic
1091215261 11:133897336-133897358 TGCACGCAAGAGAGTGAGAGCGG - Intergenic
1104354984 12:128077401-128077423 GGCACGTCGGATAGTGAGAGAGG + Intergenic
1105888913 13:24668073-24668095 GGCTCACATGATTGTGAGACTGG + Intergenic
1112721986 13:102255930-102255952 GGCATGCTTGATGGTGGGACTGG + Intronic
1113015370 13:105822928-105822950 GGCACGGACGATGGTGGGACTGG - Intergenic
1116083172 14:40202801-40202823 GGCAAGCATGAGAGCGAGGCTGG - Intergenic
1121846495 14:97176869-97176891 GGCATGCCTGATAAGGAGACTGG + Intergenic
1124245647 15:28069442-28069464 GCCCCGCATGAGAGGGAGACCGG - Intronic
1127122952 15:55786869-55786891 GGCAGGCAGGATAGTGAGCTTGG + Intergenic
1129984253 15:79902961-79902983 GAAATGCATGATAGTGACACAGG - Intronic
1131732829 15:95300218-95300240 TGCACGCATGTTAGTGAGTGTGG + Intergenic
1132584571 16:700661-700683 GGCACGGAGGATATTTAGACTGG - Intronic
1133611548 16:7438370-7438392 GGTGAGCATGATGGTGAGACAGG + Intronic
1149433174 17:56610822-56610844 GGCACTCCTGAAAGGGAGACTGG + Intergenic
1162570959 19:11472587-11472609 GGTACTCAGGATGGTGAGACAGG + Intronic
1164081989 19:21866823-21866845 GCCCCGCATGAGAGGGAGACCGG + Intergenic
926013298 2:9425167-9425189 GGCACATATGAAAGTGAGAGTGG + Intronic
935526451 2:104174509-104174531 GGCTCACCTGATTGTGAGACTGG + Intergenic
946469691 2:219947183-219947205 GGCAGGCATGAGAGTGAAAGTGG + Intergenic
1175001220 20:55632662-55632684 GGCAGGCATGGGATTGAGACCGG - Intergenic
1178685459 21:34707226-34707248 GGCACTTATAATTGTGAGACTGG + Intronic
1184200734 22:42967550-42967572 GTCTAGCATGATAGTGAAACTGG + Intronic
1184600452 22:45540271-45540293 GGCAGTAATGATAGTGATACCGG + Intronic
951357475 3:21685862-21685884 GCCACGCATGAAAGCAAGACAGG + Intronic
991254605 5:64600270-64600292 GGCACCCATGAAATTCAGACTGG - Intronic
994452136 5:99956036-99956058 GGCAAGCATGGGAGTGAGGCTGG - Intergenic
995018157 5:107336096-107336118 GGCACTCAACTTAGTGAGACTGG + Intergenic
995839480 5:116430127-116430149 GGCACACATGGTGGTGAGACCGG - Intergenic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1024880585 7:54081216-54081238 GCCACGCATGTAATTGAGACTGG + Intergenic
1032762273 7:134954775-134954797 GGCACGCAGCGTGGTGAGACTGG - Intronic
1059380398 9:113919176-113919198 GGCTGGCAGGAAAGTGAGACAGG + Intronic
1192433331 X:71127070-71127092 GGCAGGCATGATAGTGCCGCAGG - Exonic
1194324149 X:92490663-92490685 GGCACGCATGATAGTGAGACAGG - Intronic
1194341035 X:92705851-92705873 GGCACTCATTGTAGGGAGACTGG + Intergenic
1196166456 X:112540217-112540239 GGCACAAATGACAGTGAGGCAGG - Intergenic
1200632253 Y:5603768-5603790 GGCACGCATGATAGTGAGACAGG - Intronic
1200649385 Y:5822571-5822593 GGCACTCATTGTAGGGAGACTGG + Intergenic