ID: 1200640066

View in Genome Browser
Species Human (GRCh38)
Location Y:5705774-5705796
Sequence GAGCAGCCAAAGGATACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 2, 1: 0, 2: 2, 3: 10, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200640066_1200640069 1 Left 1200640066 Y:5705774-5705796 CCTAGTGTATCCTTTGGCTGCTC 0: 2
1: 0
2: 2
3: 10
4: 124
Right 1200640069 Y:5705798-5705820 GGTTAGTTCACATGAATAGATGG 0: 1
1: 0
2: 1
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200640066 Original CRISPR GAGCAGCCAAAGGATACACT AGG (reversed) Intronic
900533650 1:3166744-3166766 GAGAAGCCAGAGGACTCACTCGG + Intronic
903013367 1:20345727-20345749 TAGCAGCCAAATCATCCACTGGG - Intronic
911642816 1:100306911-100306933 GAGCAGTTACAGGATAAACTAGG + Intergenic
915633368 1:157169302-157169324 GAGCAGCCAATGGCCACAATGGG - Intergenic
916384175 1:164249247-164249269 GAGAAGCCACAGGATAAACATGG - Intergenic
917299974 1:173563101-173563123 GGGCAGCCAGAGGATAGCCTTGG + Intronic
920291750 1:204928384-204928406 TGGCAGTCAATGGATACACTGGG - Intronic
923475995 1:234331835-234331857 GAGTAGACAAAGGAGAGACTGGG - Intergenic
1072609870 10:97010968-97010990 GAGCAGCCCCTGGACACACTAGG - Intronic
1073615786 10:104993336-104993358 GAGCAGCCAAGGGAGGCACGAGG - Intronic
1074441868 10:113484726-113484748 GATCAGCTCAAAGATACACTGGG - Intergenic
1074554679 10:114477433-114477455 GAACAGCCAAAGTGTACACTGGG + Intronic
1081621343 11:44620678-44620700 GGGAAGCCACAGGATAAACTTGG + Intergenic
1081653179 11:44839283-44839305 GAGCAGACAGAGGACAGACTGGG - Intronic
1082265975 11:50118927-50118949 CAGCTGCCAAAGGATGCAGTAGG + Intergenic
1082290113 11:50359645-50359667 CAGCTGCCAAAGGATGCAGTAGG - Intergenic
1085318997 11:75562954-75562976 TGGCAGCCAAAGGAAAGACTTGG + Exonic
1087297656 11:96396362-96396384 GATCATCTAAAGGATACATTTGG + Intronic
1087637571 11:100719715-100719737 GAGCAGCAAAAGGATACTCTTGG + Intronic
1091603736 12:1933639-1933661 CAGCAGCCAAAGGAAAGGCTTGG + Intergenic
1093124326 12:15309969-15309991 GAAGAGCTAAAGGATACCCTGGG - Intronic
1100379045 12:94044590-94044612 GGGCCTCCAAAGGGTACACTTGG + Intergenic
1104162790 12:126196525-126196547 GAAAAGACAAATGATACACTGGG + Intergenic
1104568962 12:129908650-129908672 GAGAAGGCAAAGGATGCCCTTGG + Intergenic
1104761756 12:131300990-131301012 GAGCAGCCACAGGACACATGTGG - Intergenic
1104818016 12:131659794-131659816 GAGCAGCCACAGGACACATGTGG + Intergenic
1107806538 13:44158720-44158742 GCCCAGCCAATGGATACTCTGGG + Intronic
1107896940 13:44974738-44974760 GAGCAACCAAGTGATACCCTTGG - Intronic
1108666247 13:52634281-52634303 GTCCAGCCAAAAGAGACACTTGG + Intergenic
1109930799 13:69214806-69214828 AGGCACCCAAAGGGTACACTGGG - Intergenic
1110256108 13:73435668-73435690 GAGCAGCAAAAAGAATCACTGGG - Intergenic
1110311126 13:74050436-74050458 GAGGAGACAAAGGACACACAGGG + Intronic
1110542263 13:76719892-76719914 GAGAAGCCAAAGAAGAGACTTGG + Intergenic
1116069605 14:40026790-40026812 GAGTAGCAAAAGGAGACACTAGG - Intergenic
1118678298 14:68212463-68212485 GACCACCCAAAGGACACACATGG - Intronic
1121941954 14:98079427-98079449 CAGAAGCCAAAGGAAACATTAGG - Intergenic
1123857699 15:24430669-24430691 GAACAGACAAAGTATAGACTGGG - Intergenic
1125316124 15:38433572-38433594 GAGCAGCAGAAGGAAACATTTGG - Intergenic
1125914306 15:43472065-43472087 GAGCAGAGAAAGGATATAATAGG + Intronic
1127652926 15:61026736-61026758 GAACAGGCAAAGGATGCATTTGG - Intronic
1127956318 15:63856840-63856862 GAGCAGCTTAAGGATCCACCAGG - Intergenic
1132030954 15:98438216-98438238 GAGCAGTCAAAGGACACACATGG - Exonic
1137776317 16:51057234-51057256 CAGCAGCCAAGGGGGACACTTGG + Intergenic
1138909416 16:61378223-61378245 GAGCAGCAGGAGGAAACACTGGG - Intergenic
1142113421 16:88344182-88344204 GAGGAGCCGAAGGAGACACGAGG + Intergenic
1143491807 17:7289435-7289457 GAGGAGCCAAAGGATAGAGTAGG + Intronic
1144231870 17:13214395-13214417 CAGTAGCCAAGGGATACAGTAGG + Intergenic
1145830695 17:27913869-27913891 CAGCAGCCACAGAATCCACTTGG + Intergenic
1146532260 17:33618399-33618421 GAGCAGCTGAGGTATACACTTGG - Intronic
1146567814 17:33928526-33928548 GTGCAGCCAAACCATAGACTGGG + Intronic
1146636894 17:34513240-34513262 CAGCAGCCAAAGGTTCCACTGGG + Intergenic
1150980645 17:70137940-70137962 GAGCAGTGAAAGAAAACACTTGG - Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1153336763 18:3932926-3932948 GACCACCCAAAGGATAGACTGGG + Intronic
1154334588 18:13455512-13455534 GAGCAGGTAGAGGAGACACTAGG + Intronic
1156293458 18:35770219-35770241 GAGCAGTCAGAGGATACCCTTGG - Intergenic
1157767498 18:50311358-50311380 GAGCAGCCATAGCATTGACTGGG + Intergenic
1161041068 19:2111040-2111062 GAGCAGCCATAGGAGGCGCTTGG - Intronic
1162855035 19:13461584-13461606 CAGAAGCCAAAGGTTTCACTGGG + Intronic
1167611616 19:50510551-50510573 GAGCAGCCCAGGAAGACACTGGG + Intronic
1167786988 19:51645291-51645313 GAGAAGCCAAAAGAAATACTAGG + Intronic
925299217 2:2798500-2798522 AGGCAGCCAAAGGAGACACCTGG + Intergenic
937415166 2:121708988-121709010 GTACAGCCAAAGGATTCCCTTGG - Intergenic
940138452 2:150465461-150465483 CATGAGCCAAAGGATACAGTTGG - Intergenic
944245547 2:197526675-197526697 GAGCAACCAAAGAAAACCCTGGG - Intronic
944824205 2:203464700-203464722 GAGAAGACAAGGGATAAACTGGG + Intronic
945368969 2:208992780-208992802 CAGCAGTCAAAGGAGACAATAGG + Intergenic
948601434 2:239109462-239109484 GTCCAGCTACAGGATACACTTGG + Intronic
1169165590 20:3420724-3420746 CTGCAGCCAAAGTATCCACTGGG - Intergenic
1170864788 20:20143638-20143660 GGGCAGCCACAGGATTCGCTTGG - Intronic
1172014977 20:31868165-31868187 GCCCAGCCAAAGTATACACATGG - Intronic
1182698278 22:32210936-32210958 GAGAAGCTAAAGGAAGCACTGGG - Intergenic
1182888269 22:33794509-33794531 CAGCAGTAAAAGGATAGACTGGG - Intronic
1183426534 22:37742561-37742583 GAGCAGCGAAAGGAAATTCTGGG - Intronic
1183430699 22:37763895-37763917 GAGCAGGCAAGGGATACAACGGG - Intronic
1183698300 22:39435695-39435717 GAGCAGCCACCGCACACACTGGG + Intronic
949863008 3:8523629-8523651 AAGAAGCCAAAGGATAAACATGG + Intronic
951155289 3:19345284-19345306 GATCAGCAAAGGCATACACTGGG + Intronic
954100500 3:48368943-48368965 GAGAAGCAAAATGATAGACTTGG - Intergenic
954425078 3:50438904-50438926 GAGCAGCCAGAGCTAACACTCGG - Intronic
955062118 3:55502111-55502133 GAGCAGCCAAATCAGACTCTTGG + Intergenic
956860452 3:73318426-73318448 GAGAAGCCAAAGCATACAAGTGG - Intergenic
957053852 3:75429776-75429798 GGGCAGCAGAAGGGTACACTAGG + Intergenic
958288185 3:91781987-91782009 GAGCACTCAAAGTATTCACTTGG - Intergenic
958991447 3:100850659-100850681 GAACAGCCAAGGGCAACACTGGG - Exonic
967955309 3:194873267-194873289 GGGCAGCAGAAGGACACACTGGG + Intergenic
968500520 4:947761-947783 GAGCAGGCACTGGATACACCGGG + Exonic
970505090 4:16720903-16720925 GAGCAGTCTAAAGATAGACTAGG + Intronic
971776231 4:30969414-30969436 TAGGAGCTAAAGGACACACTGGG + Intronic
976610934 4:87029638-87029660 GCACAGCAAAAGGAAACACTAGG - Intronic
981798454 4:148627607-148627629 CAGCAGCCAAAAGACCCACTTGG + Intergenic
982317732 4:154048302-154048324 TTGCAGCCAAAGGATACAGGAGG + Intergenic
983731169 4:170995502-170995524 CAGAAGCCAAATGATACTCTGGG - Intergenic
987327723 5:16827733-16827755 TGGCACCTAAAGGATACACTGGG - Intronic
989636972 5:43546530-43546552 AAGCAGCCAAATGAAACATTAGG + Intronic
995217557 5:109613058-109613080 GAGCTACCAAAGGATTGACTAGG + Intergenic
995275692 5:110275136-110275158 AAGCAGACACAGGATACACGTGG - Intergenic
995611368 5:113913595-113913617 GGGCAACAAAAGGATATACTGGG + Intergenic
997090488 5:130850775-130850797 GTGGAGCCATAGGCTACACTAGG - Intergenic
1001280157 5:170381109-170381131 GAGCAGGCAGAGGATACACTAGG - Intronic
1002431797 5:179208294-179208316 GAGGGGCCCAAGGAGACACTGGG - Intronic
1004188812 6:13446538-13446560 CAACAGCCAAGGGATACACCAGG + Intronic
1008396953 6:51019935-51019957 GAGCAGCCAAAGTCTACTCTAGG - Intergenic
1011623346 6:89263394-89263416 GAGGAGCCAAAAGTTATACTTGG + Intronic
1017914414 6:158819967-158819989 GAGCAGCAACAGCATTCACTGGG + Intergenic
1019033058 6:169030152-169030174 GAGCAGCCAATGGAGGCAGTCGG + Intergenic
1022365213 7:29707456-29707478 GTGCAGCCAAAGGGCACACCAGG - Intergenic
1023867835 7:44247234-44247256 GAGCAGCAAGAGGAGGCACTGGG + Intronic
1028456770 7:91046835-91046857 GAGAAGCAAAATAATACACTTGG - Intronic
1036245786 8:7115588-7115610 GGGCATCAAAAGGATACACTGGG + Intergenic
1036896078 8:12636544-12636566 GAGCACCAAAGGGATGCACTGGG - Intergenic
1037552852 8:19992023-19992045 GAGCAGGGAAAGGATATAGTTGG - Intergenic
1039793131 8:40891359-40891381 GAGAACCCAAGGGATACACCAGG - Intronic
1039966722 8:42289314-42289336 GAGCAGCTAAAGTCCACACTGGG + Intronic
1041149034 8:54912718-54912740 GAGAAGCCAAAGGGAACACTCGG + Intergenic
1042217334 8:66439375-66439397 GAGAAGCCAGAGGAGAGACTGGG + Intronic
1042709423 8:71699838-71699860 CAGCAGCCTCAGGATTCACTCGG - Intergenic
1045505594 8:102776319-102776341 GAGCAGGCAGAGGACACATTGGG + Intergenic
1046421125 8:113983912-113983934 GATCACATAAAGGATACACTTGG + Intergenic
1047166703 8:122447237-122447259 GAGCAGCCATGGAATACAGTAGG + Intergenic
1055196864 9:73605087-73605109 GAGCAGTCAAATATTACACTTGG - Intergenic
1056880143 9:90383691-90383713 GATCAGGCAAAGGAGACACCAGG - Intergenic
1057199084 9:93130904-93130926 GAGCAGCCAAGGTGTAGACTGGG - Intronic
1057669822 9:97077499-97077521 GAGCTGGCAAGGGAGACACTGGG - Intergenic
1058089469 9:100788312-100788334 GAGCACCAAAAGGACACAATGGG + Intergenic
1187441175 X:19321735-19321757 CAGCATCCAAAGGCTAGACTTGG + Intergenic
1188596952 X:31912982-31913004 GGGAAGCCAAAGGAGACACATGG + Intronic
1188791607 X:34413323-34413345 GAGCTCCCAAAGAATGCACTGGG + Intergenic
1189601329 X:42629891-42629913 GAGCAGACTAATAATACACTTGG + Intergenic
1189774615 X:44459392-44459414 GAGCAGCCATAGGACCCACCTGG + Intergenic
1190571245 X:51784416-51784438 GAGAAGACAGAGGATAGACTTGG - Intergenic
1191786642 X:64923463-64923485 GATCACCCATAGGATAGACTGGG - Intronic
1194331364 X:92586715-92586737 GAGCAGCCAAAGGATACACTAGG - Intronic
1198190939 X:134304975-134304997 GAGGTGCCAAGGTATACACTGGG + Intergenic
1198234896 X:134727523-134727545 GGGCAGCCAAAGCAAACAGTAGG + Intronic
1198466186 X:136906835-136906857 GAGCAGCAAAAGCATCCACCAGG - Intergenic
1198802512 X:140462010-140462032 GAGCAGCTGAAGGAACCACTGGG + Intergenic
1200640066 Y:5705774-5705796 GAGCAGCCAAAGGATACACTAGG - Intronic