ID: 1200640981

View in Genome Browser
Species Human (GRCh38)
Location Y:5717637-5717659
Sequence ACATTCCCACAAATAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 2, 1: 0, 2: 13, 3: 61, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200640981_1200640982 10 Left 1200640981 Y:5717637-5717659 CCATGCACTATTTGTGGGAATGT 0: 2
1: 0
2: 13
3: 61
4: 281
Right 1200640982 Y:5717670-5717692 AACCACTATAGAGAACAGTTTGG 0: 28
1: 519
2: 1042
3: 2473
4: 4848
1200640981_1200640985 14 Left 1200640981 Y:5717637-5717659 CCATGCACTATTTGTGGGAATGT 0: 2
1: 0
2: 13
3: 61
4: 281
Right 1200640985 Y:5717674-5717696 ACTATAGAGAACAGTTTGGAGGG 0: 3
1: 9
2: 44
3: 81
4: 377
1200640981_1200640984 13 Left 1200640981 Y:5717637-5717659 CCATGCACTATTTGTGGGAATGT 0: 2
1: 0
2: 13
3: 61
4: 281
Right 1200640984 Y:5717673-5717695 CACTATAGAGAACAGTTTGGAGG 0: 29
1: 496
2: 955
3: 1372
4: 2114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200640981 Original CRISPR ACATTCCCACAAATAGTGCA TGG (reversed) Intronic
900560512 1:3303668-3303690 ACATTCCCACCAGTAGTGTGAGG + Intronic
901950341 1:12740333-12740355 ACATTCCCACCATGAGTGTACGG - Intergenic
906020911 1:42628541-42628563 AAATTCCCACATGTTGTGCAAGG + Intronic
906992316 1:50752265-50752287 ACCTTCCCACAAAAAGGGCCTGG - Intronic
908421972 1:63967685-63967707 AAAGTCACACAAATAGTACATGG - Intronic
909546790 1:76857209-76857231 ACATTAGCAGAAATATTGCAAGG + Intergenic
909592349 1:77364976-77364998 ACATTCCCAACAACAGTGTATGG + Intronic
909708561 1:78616886-78616908 ACATTCCCACCAGAAGTGTATGG - Intergenic
909731820 1:78901134-78901156 ATATGCCCCCAAATATTGCATGG - Intronic
910243375 1:85112539-85112561 ACATTCCCACTAGCAGTGTATGG + Intronic
910384893 1:86671598-86671620 ACATTCCCACCAACAGTGTACGG - Intergenic
910512258 1:88020541-88020563 ACATTCCCACCAGTGGTGTATGG + Intergenic
911387655 1:97196838-97196860 ACTTTCCTACAACTATTGCATGG + Intronic
911648292 1:100358856-100358878 GCATTCCCACAAATATTTCTAGG - Intronic
911975999 1:104495759-104495781 ACATTCCCACCAACAATGTATGG - Intergenic
912614916 1:111089549-111089571 CCATTTCCACCAATAGTGAATGG - Intergenic
912907716 1:113724153-113724175 ACATTTCCACCAACAGTGTACGG - Intronic
913711030 1:121483606-121483628 CCATTCCCACAAATATTCCCAGG - Intergenic
915711239 1:157900945-157900967 ACATTTTCACAAACAGTACAAGG + Intergenic
915818674 1:158997418-158997440 ACATTCTCACCAACAGTGTAAGG + Intergenic
916713393 1:167431486-167431508 ACACTCCCTTAAAGAGTGCAGGG + Exonic
916718640 1:167465707-167465729 AAATTCCCCCAAATAATTCAGGG - Intronic
918448409 1:184636241-184636263 TCATTGCCACCACTAGTGCAGGG - Intergenic
919139039 1:193547047-193547069 ACATTTCTACAAACACTGCAGGG + Intergenic
919446029 1:197706810-197706832 ACATTCCCACCAACAGTGTGTGG - Intronic
919675754 1:200380892-200380914 TCATCTCCCCAAATAGTGCAGGG + Intergenic
920424572 1:205864389-205864411 CCTATTCCACAAATAGTGCAGGG + Intergenic
921527371 1:216234437-216234459 ACATATCCAGAAATAGAGCATGG + Intronic
923065346 1:230512527-230512549 ACATTCCCCCTAACAGTGTATGG + Intergenic
923752068 1:236755339-236755361 GCATTTCCACAAATAGTGACTGG - Intronic
923834972 1:237600974-237600996 ACATTCCCACCAACAGTGTATGG - Intronic
924434136 1:244023614-244023636 CCATGCCCACAAATAGTCCCAGG - Intergenic
924741711 1:246797929-246797951 AGATGCCCCCAAATAGTGCATGG + Intergenic
924820278 1:247482965-247482987 ATACTCCCACTAATAGTGAATGG - Intergenic
1063074585 10:2701943-2701965 GCATTCCCTAAAATTGTGCATGG - Intergenic
1063913039 10:10851984-10852006 ACATTCCCACCAGCAGTGTATGG - Intergenic
1064271868 10:13872502-13872524 ATTTTCCCACACATCGTGCATGG - Intronic
1065098345 10:22305865-22305887 ACATTCCCACCAGTATTGTATGG - Intergenic
1067047535 10:42992931-42992953 ACATTCCCACAGAGACTTCAGGG + Intergenic
1068547248 10:58361407-58361429 ATAATCCCAGAAATAGAGCAAGG - Intronic
1070104700 10:73420526-73420548 ACTTTTCAACAAATAGTGCTGGG - Intergenic
1070479977 10:76872627-76872649 ACATTCCTACAAATACATCATGG + Intronic
1071582949 10:86790338-86790360 ATATTCCCACAAATAGTGTCTGG - Intronic
1072879555 10:99212210-99212232 ACATTCCCACCAAGTATGCAAGG - Intronic
1073560833 10:104495423-104495445 ACATTTCCACCAACAGTGTATGG + Intergenic
1073798569 10:107015344-107015366 ACACACACACAAATAGAGCAGGG + Intronic
1074227530 10:111500942-111500964 ACATTCCAACTAACAGTGCTGGG + Intergenic
1074743975 10:116513034-116513056 GCAGTTCAACAAATAGTGCATGG + Intergenic
1075358889 10:121811552-121811574 ACATTCCCAGACATAGCCCAAGG - Intronic
1076100650 10:127774948-127774970 TCAAACCCACAAAAAGTGCAAGG - Intergenic
1077270454 11:1676088-1676110 TCTTTTCCACAAATAGTGCTGGG - Intergenic
1077521276 11:3036559-3036581 ACATTCCCACCCATAGTGCATGG - Intronic
1078535432 11:12169855-12169877 ATACTCCCACCAATAGTGCAAGG + Intronic
1079071973 11:17355044-17355066 CTATTCCAACAAAAAGTGCAAGG - Intronic
1079113517 11:17622950-17622972 ACATTCCCACCAAAAGTGTGAGG + Intronic
1079517153 11:21282558-21282580 ACATTCCCACCAACAGTGTTGGG - Intronic
1079520590 11:21321794-21321816 ACAGTCCCACACATGGTGTAAGG + Intronic
1080316085 11:30950231-30950253 ACATTCCCACCAACAGTGTAGGG - Intronic
1080601350 11:33823206-33823228 ACATTCCCACCAACAGTATACGG + Intergenic
1081624944 11:44648436-44648458 ACATTTCCACAAGCAGTGTATGG - Intergenic
1081830251 11:46104640-46104662 ACAGTCCCACTAAAAGTTCATGG - Intronic
1082332234 11:51234017-51234039 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082337145 11:51305091-51305113 ACATTCCTATAGATAGAGCATGG + Intergenic
1082350826 11:51503829-51503851 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082392583 11:52111791-52111813 ACATTCCTATAGATAGAGCATGG + Intergenic
1082394704 11:52142542-52142564 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082468040 11:53203392-53203414 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082528231 11:54072744-54072766 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082532183 11:54129724-54129746 ACATTCCTATAGATAGAGCAGGG + Intergenic
1083097803 11:60269488-60269510 ACATTCCCACAAGCAGTGTATGG + Intergenic
1085327705 11:75619923-75619945 ACATTCCCACCAACAGTGTATGG + Intronic
1085813948 11:79715920-79715942 ACATTCCCACCAATGGTAAACGG + Intergenic
1086897105 11:92325933-92325955 ACATCCCCACAAATAAAGAATGG - Intergenic
1087145431 11:94806100-94806122 ACATGCCCACTGACAGTGCAGGG + Intronic
1087316415 11:96608582-96608604 TCATTCCCAGAAAAAGTACATGG - Intergenic
1087350523 11:97026100-97026122 ACATTCCCACCAACAATGTACGG - Intergenic
1087932511 11:103994223-103994245 ACATTAGCACTAATAGTGCTTGG + Intronic
1088405681 11:109475267-109475289 ACATTCCCACCAATAATGTTTGG - Intergenic
1088994900 11:114987707-114987729 ACATGCCCACAAGGACTGCAGGG + Intergenic
1089734812 11:120543069-120543091 ACATTCCCACCAACAGTGTACGG - Intronic
1093345862 12:18037760-18037782 TCCTTCCCACAAAGAGTCCATGG - Intergenic
1094091285 12:26652992-26653014 ACATTCCCTCAATTCTTGCAAGG + Intronic
1095491491 12:42739211-42739233 ACCTTCCCACCAACAGAGCATGG - Intergenic
1099113168 12:78587413-78587435 TCATTCCCCCTAAAAGTGCATGG + Intergenic
1101664353 12:106797048-106797070 ACATTCCCACCAGCAGTGTATGG - Intronic
1104225157 12:126824398-126824420 ACATTCCAACCAACAGTGTATGG + Intergenic
1105530353 13:21213413-21213435 ACATTCCCACCAACAGTACAAGG - Intergenic
1105837656 13:24224702-24224724 CCATTCCCACTAATACTGTAAGG - Intronic
1106091659 13:26600871-26600893 ACATTCCCACAACTAAGGAAAGG - Intronic
1107224124 13:38026567-38026589 ACATTCCCACCAACAGTGTATGG + Intergenic
1107347294 13:39475526-39475548 ACATGCCCACCAAAATTGCAAGG + Intronic
1108131719 13:47309164-47309186 ACATTCCCACCAACAGCGTACGG + Intergenic
1108232037 13:48355454-48355476 ACATTCCCACCAACAGTGTACGG - Intronic
1111159507 13:84375450-84375472 ACATTCCCACCAACAGTGTGCGG - Intergenic
1111394496 13:87647529-87647551 ACTTTCACACACATACTGCAAGG - Intergenic
1111847170 13:93525512-93525534 AAATTCCCAGAAATAAGGCAAGG - Intronic
1112741083 13:102473167-102473189 ACATTCCCACCAACAATGCACGG - Intergenic
1113248494 13:108425590-108425612 GCATTCCCTCACATAGTGTAAGG + Intergenic
1113295067 13:108950578-108950600 ACATTCCCACCAGCAATGCAGGG - Intronic
1114691766 14:24589294-24589316 CCTTTTCCACAAATAGTGCTGGG - Intergenic
1116413436 14:44651733-44651755 ACATTCCCTTCAACAGTGCATGG - Intergenic
1119231211 14:72981325-72981347 ACATTTCCCCTAATAGTGAAAGG + Intronic
1120107178 14:80509252-80509274 ACATTCCAACCAACAGTGTATGG + Intronic
1121178154 14:91906490-91906512 TCACACCCACAAACAGTGCAGGG + Intronic
1121477315 14:94221743-94221765 ATATTCCCACCAACAGTGTAAGG - Intronic
1121943658 14:98097511-98097533 GCCTTCCCACAAATATGGCAGGG + Intergenic
1121975538 14:98400409-98400431 ACATTCCCACCCATTGTCCAAGG - Intergenic
1122125428 14:99576130-99576152 ACAATCCCACAAAGAGGGCCAGG + Intronic
1123174587 14:106404435-106404457 ACATTCTCACTTAAAGTGCAAGG + Intergenic
1124424122 15:29548842-29548864 ACATTCCCACAAACGATTCAGGG + Intronic
1124572761 15:30881062-30881084 ACATTCCCACCAATAGTGTATGG + Intergenic
1125127684 15:36243162-36243184 ACATTCCCACCAGCAGTGTAAGG + Intergenic
1125267784 15:37903322-37903344 ACATTCCCACATATAGGAAAAGG - Intergenic
1127242286 15:57129664-57129686 TCATTCTCAAAAATAGTGCAAGG - Intronic
1128388864 15:67169366-67169388 AGATTCCCACAAACAGCGCAAGG + Intronic
1129085501 15:73085578-73085600 AAATTCCCACCAACAGTGTATGG + Intronic
1131320689 15:91387383-91387405 ACATTCCCACCAATAGTATATGG + Intergenic
1131658772 15:94491178-94491200 ACATTCCCACTAACAGTGTATGG - Intergenic
1133911976 16:10074261-10074283 ACATTCTCACAATCAGTGTACGG - Intronic
1135609220 16:23850730-23850752 ACATTCCCACCAACAGTGTATGG + Intronic
1136423483 16:30152580-30152602 ACATTCCCACCAACAGTGCACGG - Intergenic
1137629539 16:49932479-49932501 ACATTCCAACAAGTTCTGCAGGG + Intergenic
1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG + Intronic
1139555592 16:67707421-67707443 ACATTCCCACCAAGAATGTATGG - Intronic
1140843025 16:78859391-78859413 AGATTCCCAAAAGTACTGCAAGG - Intronic
1141125904 16:81401052-81401074 ACACTCCAACAAATTGTGCATGG + Intergenic
1145292699 17:21561910-21561932 ATATTCCCACCAACAATGCATGG + Intronic
1145387270 17:22424032-22424054 ACATTCCCACCAACAATGCATGG - Intergenic
1149013141 17:51878340-51878362 ACATTTCTACAACTAATGCAGGG - Intronic
1149956875 17:61060994-61061016 ACAAGCCCACAACTACTGCAGGG - Intronic
1150151939 17:62817078-62817100 ACATTCCCACCAACAGTGTATGG - Intergenic
1150194250 17:63278513-63278535 ACATTCCCACCAACAGTGTATGG - Intronic
1151949720 17:77344393-77344415 ACATTCCCACCAGCAGTGCACGG - Intronic
1153531563 18:6051708-6051730 ACAGTCCCACAAATACAGGAAGG - Intronic
1153721517 18:7908179-7908201 ATATTCCCACCAGCAGTGCATGG + Intronic
1154300787 18:13190594-13190616 ACATTCCTACAAATAATGCAAGG - Intergenic
1154387470 18:13907915-13907937 ACCTTCCCACCAACAGTGTACGG - Intronic
1154436304 18:14344588-14344610 ACAATTCCAGAAATAGTCCAGGG + Intergenic
1155773585 18:29730275-29730297 ACATTCCCACCAACAGTGTATGG - Intergenic
1157223580 18:45843519-45843541 ACATTCCCACCAATAGTATATGG - Intronic
1157791616 18:50536795-50536817 ACAGTCCCAGAATTAATGCAGGG + Intergenic
1158727515 18:59986997-59987019 ACATTCCCACATATACAGCATGG - Intergenic
1159893488 18:73974541-73974563 TCATTATCACAAATAGTGAAAGG + Intergenic
1162681685 19:12348444-12348466 ACATGCCAACAAACACTGCAAGG + Intergenic
1162685382 19:12378609-12378631 ACATGCCAACAAACACTGCAAGG + Intergenic
1163574762 19:18104217-18104239 AAATTCCCACAACTATTGGAAGG + Intronic
1165345539 19:35246833-35246855 ACATTCCCACCAGCAATGCACGG - Intergenic
1165897131 19:39149060-39149082 ACATTCTCACAAGCAATGCACGG - Intronic
1167111779 19:47466628-47466650 GCATTCCCACCAGCAGTGCATGG - Intronic
1168031308 19:53682120-53682142 AGATTCCCACAAAAAATCCACGG + Intergenic
925290398 2:2744378-2744400 ACATTCACACAAACAGTGACTGG - Intergenic
926736274 2:16075574-16075596 ACATTCCCACAAAGAATGCGTGG + Intergenic
927409609 2:22809094-22809116 AAATTCCCAGAAATAGTGAGTGG - Intergenic
928053798 2:28029804-28029826 ACATTCCCATCAACAGTGCATGG + Intronic
929147883 2:38722395-38722417 ACATTCTCTGAAATAGGGCATGG + Intronic
929211632 2:39364049-39364071 ACATTCCCATCAACAGTGGACGG - Intronic
929235643 2:39602773-39602795 ACACTCCTACTAACAGTGCATGG + Intergenic
929711239 2:44268943-44268965 ACAATCCCACTAACAGTGCACGG - Intergenic
931258197 2:60593357-60593379 GCATTCCCACCAACAGTGTATGG - Intergenic
931595426 2:63937527-63937549 ACATTTCCACCAATAGTGCAGGG - Intronic
932541017 2:72652294-72652316 ACATTTTCTCAAATACTGCATGG - Intronic
932579320 2:72983269-72983291 ACCTTCTCCCAAATAGTGCCAGG + Intronic
932785796 2:74602464-74602486 TAATTCCCACAACTACTGCATGG + Intronic
933175853 2:79172177-79172199 ACATTCCCACCAACAGTATATGG - Intergenic
933331173 2:80895091-80895113 ACATTCCCACAAACAGGAGATGG - Intergenic
935062082 2:99617261-99617283 GCATTCCCACCAGGAGTGCATGG + Intronic
935121747 2:100189101-100189123 ACATTCCCACCCATAGTGCAGGG + Intergenic
935521283 2:104108061-104108083 ACAGTCCCACCAACAGTGTAGGG + Intergenic
935926538 2:108075734-108075756 ACATTCCCACAGATAGTAAGTGG + Intergenic
937683299 2:124667661-124667683 ACATTAACATTAATAGTGCATGG + Intronic
938232809 2:129676161-129676183 ACATTCCCACCAGCAGTGTATGG + Intergenic
940314491 2:152313226-152313248 ACATTCCCACCAACAATGTATGG + Intergenic
940914654 2:159240976-159240998 ACATTTCCAGAACTAGTGAAAGG + Intronic
942020417 2:171862380-171862402 ACAATCCCACAAATAATACTTGG + Intronic
942164075 2:173224278-173224300 ACATTCTTACATAAAGTGCAGGG - Intronic
942266529 2:174232744-174232766 ACATTCCTACCAGCAGTGCACGG - Intronic
943419523 2:187653426-187653448 ACATTCCCACCAATGCAGCAAGG - Intergenic
943857019 2:192808681-192808703 ACATACTCACAGATAGTCCAAGG - Intergenic
944973342 2:205019591-205019613 ACATTCCCACCAGCAGTGTATGG + Intronic
947317626 2:228878638-228878660 ACATTCCCTAAAATAGTACCTGG + Intronic
1169334580 20:4745399-4745421 CCAATCCCACCAATAGTGCATGG - Intergenic
1172797293 20:37549601-37549623 TCATTCCCACTAACAGTGTATGG + Intergenic
1172818776 20:37713146-37713168 CCATTCCCACAAAACTTGCAAGG + Intronic
1175137259 20:56833481-56833503 ACAGTGCCAGAAACAGTGCAAGG + Intergenic
1175654536 20:60757906-60757928 ACATTCCCACCAACAGTGGATGG + Intergenic
1178403104 21:32304112-32304134 TCCTTCCTAAAAATAGTGCAGGG - Intronic
1179439272 21:41381764-41381786 ACATTCCCACCAGCAGTGGAGGG - Intronic
1182134470 22:27888419-27888441 ACATTCCCACAGACAATGTATGG + Intronic
1184635868 22:45830744-45830766 ACATTCCCATCAGTAATGCATGG - Intronic
951225334 3:20114248-20114270 AAATTCCCACAACTAGTAAATGG - Intronic
951276369 3:20691372-20691394 ACATTCCCACACACAGTTCTTGG - Intergenic
951279809 3:20734217-20734239 ACATTGCCAAAAACAGTGCCGGG - Intergenic
952332774 3:32379969-32379991 ACATTTCCACCAAGCGTGCAAGG - Intergenic
952549216 3:34457094-34457116 TCATGCCCACAAGTGGTGCATGG + Intergenic
953722893 3:45371780-45371802 ACATTCCCACCAACAGTGTGAGG - Intergenic
956975905 3:74578820-74578842 ACGTTCCCTGAAATACTGCAAGG + Intergenic
957628307 3:82683785-82683807 ACATTCCCACCAACAGTGCATGG + Intergenic
957888862 3:86328526-86328548 ACATTCCCATAAAGTATGCAGGG - Intergenic
958073778 3:88650109-88650131 ACATTCCCACTAACAATGTAAGG - Intergenic
958668695 3:97174504-97174526 ACATTCCCACACAGTATGCAAGG + Intronic
958763553 3:98337949-98337971 ACATTCCAATAAATAGTACTGGG + Intergenic
958842428 3:99223670-99223692 ACATTCCCACCTACAGTGTATGG - Intergenic
959570263 3:107875299-107875321 AAATTCCCAAAGATAGTGGAAGG + Intergenic
959975535 3:112454658-112454680 ACTTTCCCCAAAATAGGGCAGGG + Intergenic
960505684 3:118490496-118490518 ACATTTCCACCAACAGTGTAAGG - Intergenic
961192756 3:124976107-124976129 ACATTCCCACTAGCAGTGTATGG + Intronic
961770549 3:129246609-129246631 ACATTCCCACCAGCAGTGTATGG - Intergenic
961861322 3:129918835-129918857 AGAGTCCCACACATTGTGCATGG + Intergenic
962872450 3:139509467-139509489 AAATTCCCATCAAAAGTGCAGGG - Intergenic
962887773 3:139643248-139643270 ACATTCCCACCAACAATGCACGG - Intronic
963552151 3:146737537-146737559 ACATTCCTACCAGCAGTGCATGG + Intergenic
963577178 3:147075610-147075632 ACACTCCCACCAACAGTGTAAGG + Intergenic
963645768 3:147912330-147912352 ACATTCCCACCAACAGTCTATGG - Intergenic
963830146 3:149998855-149998877 ACATTCCCACCAACAGTGACTGG - Intronic
964073862 3:152669145-152669167 AAATGCCCACCAATAGTACATGG - Intergenic
964152417 3:153543362-153543384 ACATTCCCACCAACAGTATATGG + Intergenic
964815446 3:160713045-160713067 ACACTCCCACTAACAGTGTAAGG - Intergenic
964853165 3:161117214-161117236 ACATTCCCACCAACAGTGTATGG - Intronic
966514400 3:180801861-180801883 ACATTCCTACAAAATGTACAAGG - Intronic
967571104 3:191029270-191029292 TCATTCCCACAAATATTCCCTGG + Intergenic
968009181 3:195261902-195261924 ACATTCCCACCAGCAGTGTATGG - Intronic
968159316 3:196412468-196412490 ATATTCCCATCAAGAGTGCATGG - Intronic
968169686 3:196500038-196500060 ACATTCCCACCAACAGTGCGTGG - Intronic
968527491 4:1069694-1069716 GCATTCCCACCAATAGAGGATGG + Intronic
968892643 4:3378788-3378810 ACATTCCCACCAACAGTGCAAGG - Intronic
969045642 4:4334654-4334676 CCATTCCCACCAATGGTGCATGG - Intergenic
969305214 4:6322428-6322450 AGATTCCAAAAAATCGTGCATGG + Exonic
970411381 4:15811502-15811524 ACTTTTCAACAAATGGTGCAGGG - Intronic
970487229 4:16536744-16536766 ACCTTCCCAAAGATTGTGCAGGG + Intronic
970607170 4:17691729-17691751 ACATTCACAGAAATAGGTCAGGG + Intronic
970851249 4:20605585-20605607 ACATACCCACATGTAATGCATGG - Intronic
970869336 4:20797466-20797488 ACATTCCCAGAGATTATGCAGGG - Intronic
971307826 4:25498923-25498945 ACACACACACAAATAGTGCCAGG - Intergenic
971798867 4:31262385-31262407 ACTTGCTCACAAATAGTGCATGG + Intergenic
975641987 4:76510021-76510043 ACAGTCCCACCAATAGTATATGG - Intronic
976874056 4:89833156-89833178 ACATTCCCACAAAAACTGCAAGG + Intronic
976961019 4:90973545-90973567 ACATTCCCACCAACTGTACAAGG - Intronic
977719062 4:100217622-100217644 ACATTTCCACTAACAGTGTATGG + Intergenic
978302732 4:107290065-107290087 AAATTCCCACCAATAATGTATGG + Intergenic
978827897 4:113046814-113046836 ACATTCAAACATACAGTGCATGG - Intronic
979679285 4:123442205-123442227 ACATTCCTACTGACAGTGCAAGG + Intergenic
980597589 4:134974597-134974619 ACATTCCCACCAACAGTGCACGG - Intergenic
980702909 4:136455708-136455730 ACATTCCCACCAAGTGTGCTAGG - Intergenic
980753208 4:137119868-137119890 ACATTTCCACCAACAGTGTATGG - Intergenic
981492667 4:145356756-145356778 ACATTCCCACCAACAGTGTATGG - Intergenic
981760352 4:148187952-148187974 ACATTTCAACAAATGGTGCTGGG - Intronic
982990594 4:162268954-162268976 ACATTTCCACCAACAGTGTATGG - Intergenic
983292513 4:165824410-165824432 ACAGTCCCACCAACAGTGTAAGG - Intergenic
983389314 4:167108190-167108212 ACATTCCCACCAACAGTGTACGG - Intronic
983918998 4:173325178-173325200 ACATTCCCAACCATGGTGCAAGG + Intergenic
985684423 5:1274294-1274316 ACACGCCCACAAATAGCCCATGG + Intronic
986434738 5:7718096-7718118 ACAGGGCCTCAAATAGTGCATGG + Intronic
987402608 5:17493233-17493255 ACATTCCCAGGAATAATACAAGG + Intergenic
987403821 5:17504681-17504703 ACGTTCCCATGAATAGTGCAAGG + Intergenic
987404259 5:17509041-17509063 ACATTCCCAGGAAGAATGCAAGG + Intergenic
987411290 5:17617426-17617448 ACGTTCCCATGAATAGTGCAAGG + Intergenic
987413718 5:17640742-17640764 ACGTTCCCATGAATAGTGCAAGG + Intergenic
991648347 5:68824347-68824369 ACATACTCTCAAATAGTTCAGGG + Intergenic
992660248 5:78952639-78952661 ACATTCCCATCAAGAATGCATGG - Intronic
993936189 5:94005917-94005939 ACATTCCCACCAGCAGTGTATGG - Intronic
994395500 5:99223131-99223153 ACATTACCCCGAATATTGCAGGG - Intergenic
994567264 5:101466067-101466089 TCATTCCCACCAACAGTGTATGG + Intergenic
994974478 5:106784162-106784184 ACATTCCCACCAACAGTGTATGG - Intergenic
996041420 5:118817311-118817333 ACATTCCCACCAACAGTGTATGG - Intergenic
996132830 5:119802716-119802738 ACATTCCCACCAAGTGTTCAAGG + Intergenic
1001869936 5:175144023-175144045 ACATTCCCCAAAAAAATGCAAGG + Intergenic
1001929554 5:175663278-175663300 ACATTCCCACCAGCAGTGCACGG + Intronic
1003401144 6:5792149-5792171 ACATTCCCACCAACAGTACAAGG + Intergenic
1009572449 6:65404366-65404388 ATATTCCCAGGATTAGTGCATGG + Intronic
1009587860 6:65629124-65629146 TCAGTTCAACAAATAGTGCAAGG + Intronic
1009636426 6:66270809-66270831 GCATTCCCACCAACAGTGTATGG - Intergenic
1010351696 6:74882479-74882501 AATTTCCCACCAATAGAGCATGG + Intergenic
1010948892 6:82011550-82011572 ACATTCCCATCAACAGTACAGGG - Intergenic
1011547387 6:88496119-88496141 ACATTCCCACCCTTAGTGGAAGG - Intergenic
1012419385 6:99046701-99046723 ACATTCCCACAGAGTGTGAAAGG + Intergenic
1014399511 6:120970246-120970268 ACATTCCCACCAATAGTACCAGG - Intergenic
1014479182 6:121914211-121914233 ACATTCCCACCAACAGTGTATGG + Intergenic
1016889422 6:148991178-148991200 AGATCCCCACAAAAAGTTCATGG + Intronic
1017292255 6:152752518-152752540 ACATTCCCAAACATGGTGAAAGG + Intronic
1018086758 6:160307824-160307846 ACATTCCCACCAAATGTGGAAGG + Intergenic
1020399031 7:7753880-7753902 ACATTCCCACCAACAGTGTACGG + Intronic
1022610415 7:31866546-31866568 ACATGACCACAAATACTTCATGG - Intronic
1023528485 7:41129791-41129813 GCATTCCAACACATGGTGCAGGG + Intergenic
1023561945 7:41484251-41484273 ACTTTTCAACAAATAGTGCTGGG + Intergenic
1023584274 7:41712857-41712879 ACATTCCAACCAATAGTGTAAGG + Intergenic
1023964885 7:44958303-44958325 ACATTCCCACAACTAATACATGG - Intergenic
1024526210 7:50351655-50351677 ACATAGCCCCAGATAGTGCAGGG - Intronic
1025111303 7:56218524-56218546 ACACTTCCACAAATAGAGGATGG + Intergenic
1028541180 7:91944172-91944194 AAATGCCCACAAATAATGCCAGG + Intronic
1029054126 7:97722275-97722297 ACATTCCCACTAACAGTGCACGG - Intergenic
1030054876 7:105575224-105575246 GAATTCCCACACATTGTGCAAGG - Intronic
1030547467 7:110914974-110914996 ACATTCCCACCAAGTGTACAAGG - Intronic
1031301479 7:120066959-120066981 TCATTCCCACATATTGTGGAAGG + Intergenic
1032241454 7:130162379-130162401 ACATTGCCCCAAATGCTGCAGGG - Intergenic
1032665776 7:134034811-134034833 ACATATACACAAATAGTGCTTGG - Intronic
1034822253 7:154226962-154226984 ACATTGCCACCAATAGCACAGGG - Intronic
1037896530 8:22660099-22660121 ACTTCCCCCCAAATAGTGAAAGG + Intronic
1038809507 8:30826099-30826121 GCATTCCCACTAAAAGTGCATGG + Intergenic
1040575948 8:48651701-48651723 ATATTCCCACACATAATGCCTGG + Intergenic
1041517037 8:58711739-58711761 ACATTCCCACCAGTAGTGTGTGG - Intergenic
1042046260 8:64655555-64655577 ACACTCCCACCAACAGTGTAAGG - Intronic
1042268219 8:66930050-66930072 ACTTTCCAACAAATGGTGCTGGG + Intergenic
1042794970 8:72652078-72652100 ACCTTCCCACCACTAGTCCAAGG + Intronic
1043268078 8:78291714-78291736 CCACACCCACAAATACTGCATGG + Intergenic
1043321734 8:78995311-78995333 ACATTCCCACCAACAGTGCATGG - Intergenic
1043340772 8:79235738-79235760 ACATTTCCACCAACAGTGTATGG - Intergenic
1043635084 8:82375188-82375210 ACATTACTACCAATATTGCAGGG + Intergenic
1043852621 8:85232222-85232244 ACATTTCTACCAATAGTGTATGG + Intronic
1044160327 8:88905616-88905638 ACATTCCCACTAACAGTATATGG - Intergenic
1044480680 8:92683928-92683950 ACATTCCAACAAAATGTGCACGG + Intergenic
1045359234 8:101416811-101416833 ACATTCCCACCAACAATGTAGGG - Intergenic
1045924363 8:107568617-107568639 ATATTACTACCAATAGTGCAGGG + Intergenic
1045924750 8:107571099-107571121 ATATTACCACAAATATCGCAGGG + Intergenic
1045927109 8:107586835-107586857 ACATTCCTCCCAATATTGCAGGG - Intergenic
1048791255 8:138106133-138106155 ACAATGCCCCAAACAGTGCAGGG - Intergenic
1049834323 8:144724307-144724329 ACAGTCCCACCAACAGTACACGG - Intronic
1051628867 9:19124618-19124640 ACATTCCCACCAACACTGTATGG - Intronic
1052345449 9:27404869-27404891 ACATTCCCACCAACAGTGTATGG + Intronic
1052509340 9:29395084-29395106 ACATTCCCACCAATAATGTAAGG - Intergenic
1055487057 9:76766567-76766589 AGATTCCCAGAAAAAGTGGATGG - Intronic
1056030950 9:82552588-82552610 AAGTTACCACAAATACTGCATGG + Intergenic
1056888583 9:90468297-90468319 AAATGCCCTCCAATAGTGCAGGG - Intergenic
1057732830 9:97625513-97625535 ACATTCCCACCAACAGTGACTGG + Intronic
1059557607 9:115297119-115297141 ACATTCTCTCAAAGAGTTCAGGG + Intronic
1061459946 9:130729502-130729524 ACCTTCCCAAACACAGTGCAGGG - Intronic
1061879136 9:133559958-133559980 TCATCCCCACAAATACTGCCTGG + Intronic
1185881779 X:3747651-3747673 ACATTACCAGCAAGAGTGCATGG - Intergenic
1186838024 X:13457284-13457306 ACATTCCAAGAAAAAGTACAGGG - Intergenic
1189076885 X:37925489-37925511 CCATTCCCACCAACAGTGTATGG + Intronic
1189932261 X:46025777-46025799 ACTTTTCAACAAATAGTGCTGGG - Intergenic
1190532292 X:51391603-51391625 ACATTCCCACTAACAGTGTATGG - Intergenic
1190731733 X:53231118-53231140 ACATTGCCCCATATAGTGCCTGG - Intergenic
1190912320 X:54784727-54784749 ACATTCCCACCAACTGTGTATGG - Intronic
1190918941 X:54831814-54831836 ACATTCCCACCAACAGTGTATGG + Intergenic
1190943045 X:55062203-55062225 ACATAGCCACCAACAGTGCAGGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192615013 X:72610728-72610750 CCATTCCCACTAATGGTGTATGG + Intronic
1193417642 X:81242922-81242944 ACATTCCCACCAACAGTGTATGG - Intronic
1193585323 X:83314235-83314257 ACATTCCCACCAACAGTGTTTGG - Intergenic
1194332276 X:92598586-92598608 ACATTCCCACAAATAGTGCATGG - Intronic
1194927104 X:99838023-99838045 AAATTCCCACATGTTGTGCAAGG + Intergenic
1194974948 X:100385182-100385204 ATACTCCCACCAATAATGCATGG + Intronic
1196500003 X:116369563-116369585 ACATTCCCACCAACAGTGCAAGG + Intergenic
1196514857 X:116597702-116597724 ACATTCCCACCAAGTGTACAAGG + Intergenic
1197484268 X:127028098-127028120 ACATTCCCACTAACAGTGTATGG - Intergenic
1197639156 X:128948984-128949006 GCATAACCACAAATAGAGCAAGG + Intergenic
1197826159 X:130592533-130592555 ACATTCTCACCAACAGTGTATGG + Intergenic
1198553607 X:137769751-137769773 ACATTACCACCATTAGTGTATGG + Intergenic
1199014289 X:142794474-142794496 TCTTTCCAACAAATAGTGCTGGG - Intergenic
1199618026 X:149673862-149673884 ACATTCCCACCAACAGTGTATGG - Intergenic
1199624616 X:149729387-149729409 ACATTCCCACCAACAGTGTATGG + Intergenic
1200271787 X:154691924-154691946 ACTTTCCAACAAATGGTGCTGGG + Intronic
1200640981 Y:5717637-5717659 ACATTCCCACAAATAGTGCATGG - Intronic
1201147310 Y:11072408-11072430 ACACTGCCACAAATACTGGAGGG + Intergenic
1201734904 Y:17248748-17248770 AAATGGCCACAAAAAGTGCAAGG - Intergenic
1201917874 Y:19202295-19202317 ACATTACCATCAAGAGTGCATGG + Intergenic
1202084049 Y:21117246-21117268 ATATTCCCACCAAGAGTACAAGG + Intergenic