ID: 1200643093

View in Genome Browser
Species Human (GRCh38)
Location Y:5746969-5746991
Sequence TGCAGCTCTGGTTGCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200643093_1200643104 27 Left 1200643093 Y:5746969-5746991 CCAGAGGGGCAACCAGAGCTGCA No data
Right 1200643104 Y:5747019-5747041 GTGGCCAAAGAGTGCTTTGCTGG No data
1200643093_1200643102 8 Left 1200643093 Y:5746969-5746991 CCAGAGGGGCAACCAGAGCTGCA No data
Right 1200643102 Y:5747000-5747022 TGCTTGAGCCACAGATGGGGTGG No data
1200643093_1200643099 4 Left 1200643093 Y:5746969-5746991 CCAGAGGGGCAACCAGAGCTGCA No data
Right 1200643099 Y:5746996-5747018 GGCCTGCTTGAGCCACAGATGGG No data
1200643093_1200643098 3 Left 1200643093 Y:5746969-5746991 CCAGAGGGGCAACCAGAGCTGCA No data
Right 1200643098 Y:5746995-5747017 GGGCCTGCTTGAGCCACAGATGG No data
1200643093_1200643100 5 Left 1200643093 Y:5746969-5746991 CCAGAGGGGCAACCAGAGCTGCA No data
Right 1200643100 Y:5746997-5747019 GCCTGCTTGAGCCACAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200643093 Original CRISPR TGCAGCTCTGGTTGCCCCTC TGG (reversed) Intergenic