ID: 1200643100

View in Genome Browser
Species Human (GRCh38)
Location Y:5746997-5747019
Sequence GCCTGCTTGAGCCACAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200643091_1200643100 15 Left 1200643091 Y:5746959-5746981 CCTGTGCCTTCCAGAGGGGCAAC No data
Right 1200643100 Y:5746997-5747019 GCCTGCTTGAGCCACAGATGGGG No data
1200643096_1200643100 -7 Left 1200643096 Y:5746981-5747003 CCAGAGCTGCACCTGGGCCTGCT No data
Right 1200643100 Y:5746997-5747019 GCCTGCTTGAGCCACAGATGGGG No data
1200643087_1200643100 28 Left 1200643087 Y:5746946-5746968 CCATGGTTTAACACCTGTGCCTT No data
Right 1200643100 Y:5746997-5747019 GCCTGCTTGAGCCACAGATGGGG No data
1200643093_1200643100 5 Left 1200643093 Y:5746969-5746991 CCAGAGGGGCAACCAGAGCTGCA No data
Right 1200643100 Y:5746997-5747019 GCCTGCTTGAGCCACAGATGGGG No data
1200643092_1200643100 9 Left 1200643092 Y:5746965-5746987 CCTTCCAGAGGGGCAACCAGAGC No data
Right 1200643100 Y:5746997-5747019 GCCTGCTTGAGCCACAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200643100 Original CRISPR GCCTGCTTGAGCCACAGATG GGG Intergenic