ID: 1200643102

View in Genome Browser
Species Human (GRCh38)
Location Y:5747000-5747022
Sequence TGCTTGAGCCACAGATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200643096_1200643102 -4 Left 1200643096 Y:5746981-5747003 CCAGAGCTGCACCTGGGCCTGCT No data
Right 1200643102 Y:5747000-5747022 TGCTTGAGCCACAGATGGGGTGG No data
1200643091_1200643102 18 Left 1200643091 Y:5746959-5746981 CCTGTGCCTTCCAGAGGGGCAAC No data
Right 1200643102 Y:5747000-5747022 TGCTTGAGCCACAGATGGGGTGG No data
1200643092_1200643102 12 Left 1200643092 Y:5746965-5746987 CCTTCCAGAGGGGCAACCAGAGC No data
Right 1200643102 Y:5747000-5747022 TGCTTGAGCCACAGATGGGGTGG No data
1200643093_1200643102 8 Left 1200643093 Y:5746969-5746991 CCAGAGGGGCAACCAGAGCTGCA No data
Right 1200643102 Y:5747000-5747022 TGCTTGAGCCACAGATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200643102 Original CRISPR TGCTTGAGCCACAGATGGGG TGG Intergenic