ID: 1200643104

View in Genome Browser
Species Human (GRCh38)
Location Y:5747019-5747041
Sequence GTGGCCAAAGAGTGCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200643093_1200643104 27 Left 1200643093 Y:5746969-5746991 CCAGAGGGGCAACCAGAGCTGCA No data
Right 1200643104 Y:5747019-5747041 GTGGCCAAAGAGTGCTTTGCTGG No data
1200643096_1200643104 15 Left 1200643096 Y:5746981-5747003 CCAGAGCTGCACCTGGGCCTGCT No data
Right 1200643104 Y:5747019-5747041 GTGGCCAAAGAGTGCTTTGCTGG No data
1200643097_1200643104 4 Left 1200643097 Y:5746992-5747014 CCTGGGCCTGCTTGAGCCACAGA No data
Right 1200643104 Y:5747019-5747041 GTGGCCAAAGAGTGCTTTGCTGG No data
1200643101_1200643104 -2 Left 1200643101 Y:5746998-5747020 CCTGCTTGAGCCACAGATGGGGT No data
Right 1200643104 Y:5747019-5747041 GTGGCCAAAGAGTGCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200643104 Original CRISPR GTGGCCAAAGAGTGCTTTGC TGG Intergenic