ID: 1200648004

View in Genome Browser
Species Human (GRCh38)
Location Y:5809497-5809519
Sequence CTGCGAAAATGAATCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200648004_1200648009 17 Left 1200648004 Y:5809497-5809519 CCCTTCAGGATTCATTTTCGCAG No data
Right 1200648009 Y:5809537-5809559 CAAGATGGCTCGCTGAAGATTGG No data
1200648004_1200648010 18 Left 1200648004 Y:5809497-5809519 CCCTTCAGGATTCATTTTCGCAG No data
Right 1200648010 Y:5809538-5809560 AAGATGGCTCGCTGAAGATTGGG No data
1200648004_1200648007 2 Left 1200648004 Y:5809497-5809519 CCCTTCAGGATTCATTTTCGCAG No data
Right 1200648007 Y:5809522-5809544 TGTGGCACAAGCCTGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200648004 Original CRISPR CTGCGAAAATGAATCCTGAA GGG (reversed) Intergenic
No off target data available for this crispr