ID: 1200648007

View in Genome Browser
Species Human (GRCh38)
Location Y:5809522-5809544
Sequence TGTGGCACAAGCCTGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200648005_1200648007 1 Left 1200648005 Y:5809498-5809520 CCTTCAGGATTCATTTTCGCAGC No data
Right 1200648007 Y:5809522-5809544 TGTGGCACAAGCCTGCAAGATGG No data
1200648004_1200648007 2 Left 1200648004 Y:5809497-5809519 CCCTTCAGGATTCATTTTCGCAG No data
Right 1200648007 Y:5809522-5809544 TGTGGCACAAGCCTGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200648007 Original CRISPR TGTGGCACAAGCCTGCAAGA TGG Intergenic
No off target data available for this crispr