ID: 1200649038

View in Genome Browser
Species Human (GRCh38)
Location Y:5817909-5817931
Sequence TGAAGGGAAGAACCAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1531
Summary {0: 5, 1: 35, 2: 214, 3: 455, 4: 822}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200649038_1200649044 25 Left 1200649038 Y:5817909-5817931 CCAGGACTTGGTTCTTCCCTTCA 0: 5
1: 35
2: 214
3: 455
4: 822
Right 1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200649038 Original CRISPR TGAAGGGAAGAACCAAGTCC TGG (reversed) Intergenic
900781059 1:4617444-4617466 TAAAGGGAAGGACCAACACCGGG + Intergenic
901173567 1:7282287-7282309 TGCATGGAAGAACCCAGTCTTGG - Intronic
902700920 1:18171330-18171352 TGCAGGGCAGAACGAAGGCCAGG + Intronic
903386970 1:22933322-22933344 TGGAGGGAAGACCCAAGCCAAGG - Intergenic
903405395 1:23091314-23091336 CGAAGGGTAGGACCAAGTTCAGG - Exonic
903978290 1:27166458-27166480 AAAAGGCAAGAACCAAGCCCTGG - Intronic
904010374 1:27386299-27386321 TGATGGGAAGCACCCAGGCCAGG - Intergenic
904378993 1:30098691-30098713 TGAAGGGGAGGAACAAGTCTGGG + Intergenic
904819444 1:33231953-33231975 TGACTCCAAGAACCAAGTCCAGG - Intergenic
905739908 1:40361262-40361284 TGAAGGGAAGAACCCAGTCCTGG + Intronic
906593292 1:47048459-47048481 TGAAGGGAAGAGCTAGCTCCTGG - Intronic
906826972 1:48992543-48992565 TGAAGGGAAGGACACAGGCCTGG - Intronic
906827092 1:48993211-48993233 TGAAGAAAAGGACCCAGTCCTGG - Intronic
906878032 1:49559021-49559043 TGAAGGGAAGAACCATGGCCTGG + Intronic
907023724 1:51094797-51094819 GGAAGGGAAGGACCCAGTCCTGG + Intergenic
907261619 1:53222488-53222510 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
908024843 1:59939638-59939660 TGAAGGGAAGAACACAAACCTGG - Intergenic
908093119 1:60707215-60707237 TGAAGGGAAGGACCCAGTCTTGG + Intergenic
908397609 1:63740665-63740687 TGAAGGGTAGGACTCAGTCCTGG - Intergenic
908944269 1:69475139-69475161 TGAAGGGAAGGACCCTGTTCTGG + Intergenic
909182327 1:72440011-72440033 TGAAGGAAAGAACCTAGTCTTGG - Intergenic
909270401 1:73617051-73617073 TGAAGGGAAGGACACAGGCCTGG - Intergenic
909309615 1:74129811-74129833 TGAAGAGAAAGACCCAGTCCTGG - Intronic
909316239 1:74223286-74223308 TGAAGGGAAGGACCAAGTTTTGG + Intronic
909320660 1:74281094-74281116 TGAAGGGAAGGACCCAGGCCTGG + Intronic
909438604 1:75672873-75672895 TGAAGGGAAGGACTCAGTCCTGG + Intergenic
909615669 1:77605756-77605778 TGAAGGGAAGGAACCAGTCCTGG + Intronic
909781894 1:79558388-79558410 TGAAGGGAAGAAACTAGTACTGG + Intergenic
910229851 1:84974556-84974578 TGAAGGGAAGAACCCATTCCTGG + Intronic
910229955 1:84975121-84975143 TGGAGGGAAGAACACAGGCCTGG + Intronic
910459950 1:87438005-87438027 CCAAGGGAAGGAGCAAGTCCTGG + Intergenic
910470446 1:87547188-87547210 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
910547319 1:88432908-88432930 TGAAGGGAGGGACCCAGTTCTGG + Intergenic
910560241 1:88582199-88582221 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
910733102 1:90420687-90420709 TGAAGGGAATGACCCAGTCCTGG + Intergenic
911239427 1:95449119-95449141 TGAAGAGAAGAATCCAGTCCTGG - Intergenic
911241389 1:95471138-95471160 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
911344025 1:96674574-96674596 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
911496483 1:98637724-98637746 TGAAGGAAAGGAACAAGTGCTGG + Intergenic
911887877 1:103326900-103326922 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
911942768 1:104068923-104068945 TGAAGGGAAGAACCCAGTTGTGG - Intergenic
912018472 1:105072418-105072440 TGAAGTGAAGGACCCAGTCCTGG - Intergenic
912036672 1:105324974-105324996 GGAGGGGAAGGACCTAGTCCTGG - Intergenic
912070756 1:105806613-105806635 TAAAGGAAAGGACCCAGTCCTGG + Intergenic
912135839 1:106659370-106659392 TGAAGGAAAGCAACCAGTCCTGG + Intergenic
912152733 1:106880012-106880034 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
912316391 1:108670827-108670849 TGAAGGGAAGGGCCCAGTCCTGG + Intergenic
912598521 1:110903544-110903566 TGAAGGGAAGAACCCAGTCCTGG + Intergenic
912601104 1:110934111-110934133 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
912633287 1:111267742-111267764 TGAAGGGAAGGACCCAGGCCTGG - Intergenic
912634528 1:111279479-111279501 AGAAGAGAAGAACCAAGTGAAGG + Intergenic
912871498 1:113311049-113311071 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
912873157 1:113328300-113328322 TGAAGGGGAGAACCCATTCCTGG - Intergenic
912906540 1:113714044-113714066 TGAAGGGAAGGATCCAGTCCTGG + Intronic
913406880 1:118504240-118504262 GGAAGGGAAGCCCCAAGCCCGGG + Intergenic
914317170 1:146524270-146524292 CCAAGGGAAGGAGCAAGTCCTGG + Intergenic
914497185 1:148209090-148209112 CCAAGGGAAGGAGCAAGTCCTGG - Intergenic
914918291 1:151831433-151831455 GGGAGGGAAGAGCCAAGTCAGGG - Intronic
915005322 1:152630051-152630073 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
915693678 1:157716568-157716590 TGAAGAGAAGGACCCAGTCCAGG - Intergenic
915840941 1:159212437-159212459 TGAAGGGAACAACCCTGTTCTGG - Intergenic
916313265 1:163419810-163419832 TGAAGGGAAGAAAGAACTGCAGG - Intergenic
916321788 1:163512771-163512793 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
916360553 1:163962685-163962707 TGAAAGGAAGGACCCAGTCCTGG + Intergenic
917003275 1:170385003-170385025 TGAAGGGAAAAACACAGGCCTGG - Intergenic
917056641 1:170989414-170989436 TGAAGGGATGAACCATGTATTGG - Intronic
917061617 1:171048213-171048235 TGAAGGGAGGAACACAGGCCTGG - Intronic
917191344 1:172422400-172422422 TGAAGGGAAGGACCCAGTCTTGG + Intronic
917300596 1:173570276-173570298 TGAAGGGAAGGACCCAGTCCTGG - Intronic
917306217 1:173628046-173628068 TGAAGGGAAGGACCCAGGCCTGG + Intronic
917377462 1:174364855-174364877 TTGAGGGAAGAACCCAGTCCTGG - Intronic
917387301 1:174491297-174491319 TGAAAGGAAGTACCCAGTCATGG - Intronic
917396955 1:174603773-174603795 TGTAGGGGAGAACCCAGTTCTGG - Intronic
918018764 1:180664365-180664387 TGAAGGGAAAAACCTAGTTCTGG - Intronic
918357976 1:183724079-183724101 TGAAGGGAAGAGCCCAGTCCTGG + Intronic
918476220 1:184928075-184928097 TGAAGGGAAGGCCCCAGTTCTGG - Intronic
918666142 1:187154049-187154071 TGAAGGGAAGGACACAGGCCTGG - Intergenic
918989965 1:191685379-191685401 TGAAGGAAAGGACTGAGTCCTGG - Intergenic
919067752 1:192714470-192714492 TGAAGGAAAGGACCTAGTCCCGG + Intergenic
919514942 1:198511142-198511164 TGAAAAGAAGGACCAAGTCCTGG - Intergenic
919943461 1:202304061-202304083 AGAAGGGAAGAACCAGGAGCTGG - Intronic
920506154 1:206516951-206516973 AGAAGGGCATAAGCAAGTCCGGG - Intronic
920744882 1:208617069-208617091 TGAAAGAAAGGACCAAGTCCTGG + Intergenic
921296192 1:213705813-213705835 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
921316807 1:213899513-213899535 TGATGGGAAGAACCAAGACAAGG - Intergenic
921769726 1:219022055-219022077 TGAAGGGAAGAACACAATTCTGG + Intergenic
921929423 1:220742996-220743018 TGAAGGGAAGGATTCAGTCCTGG - Intergenic
921993971 1:221397033-221397055 TGAAGGAAAAGACCCAGTCCTGG + Intergenic
921994079 1:221397702-221397724 TGAAGGGAAGGACACAGGCCTGG + Intergenic
922044278 1:221928444-221928466 TGAAGGGAAGAACCCAGTTTTGG + Intergenic
922045938 1:221946316-221946338 TGAAGGAAAGTATCTAGTCCTGG - Intergenic
922214048 1:223506642-223506664 TGCAGGGAAGAACCTGGCCCCGG + Intergenic
922360459 1:224817099-224817121 TTAATAGAAGAACCAAGACCAGG + Intergenic
922377116 1:224979911-224979933 TGAAGGGAAGGACCCAGTTCTGG + Intronic
922642241 1:227245733-227245755 TGAAGAGAAGGATCCAGTCCTGG + Intronic
922685391 1:227634798-227634820 TGAAGGGAAGAACACAGGCCTGG + Intronic
922765573 1:228154916-228154938 TGGAGGTAGGAACCAAGGCCTGG + Intronic
923097877 1:230789816-230789838 TGAGGGTCAGAACCAACTCCTGG - Intronic
923199840 1:231700777-231700799 TGAATAGAAGAAGCAAGTACAGG + Intronic
924481477 1:244439382-244439404 TGAAGGGAAGGACCCAGTTCTGG - Intronic
924490837 1:244535986-244536008 TGAAGAGAAGGACCCAGTCCTGG - Intronic
924516228 1:244768459-244768481 TGATGGGAAGGACACAGTCCTGG - Intergenic
924606808 1:245542386-245542408 TGAGGGGAAGCATCCAGTCCTGG + Intronic
924768327 1:247054575-247054597 TGAAAGAAAGAACCTAGTCCTGG + Intronic
924833900 1:247628794-247628816 TGAAGGAAATTACCCAGTCCTGG - Intergenic
924898892 1:248373342-248373364 TGAAGGGAAGAACCCAATCCTGG - Intergenic
1064446563 10:15398935-15398957 TGAAGGGAAGGACTCAGTCTTGG + Intergenic
1064696821 10:17975395-17975417 TGAAGGGAAGGACCCAGTCCGGG - Intronic
1065467790 10:26044040-26044062 TAAAGGGAAGAACCAAGACCTGG - Intronic
1065921808 10:30399550-30399572 TAAAGAAAAGAACCCAGTCCTGG + Intergenic
1065991752 10:31017250-31017272 TGAGGGGAAGACCCTTGTCCAGG + Intronic
1066649747 10:37643087-37643109 TGAAGGGAAGGACAAAGTCCTGG - Intergenic
1066961149 10:42229976-42229998 TGTAGGGCAGAACCAGGGCCAGG + Intergenic
1067032636 10:42888635-42888657 TGAAGGGAAGGACCGAGTCCTGG - Intergenic
1068104045 10:52591793-52591815 TGAAGGAAAGGACCCAGTCTTGG - Intergenic
1068226142 10:54108909-54108931 TGAAGAGAAGAACCCAGTCCTGG + Intronic
1068411305 10:56659785-56659807 TGAAGAGAAGGACAAAGGCCTGG - Intergenic
1068447904 10:57146772-57146794 TAAAGGGAAGGACCCAGTCCTGG + Intergenic
1069147808 10:64917601-64917623 TAAAGGAAAGAACCCAGTCCTGG + Intergenic
1069343466 10:67439755-67439777 TGAAGGGAAAGACCAAGTCCTGG + Intronic
1069907465 10:71740173-71740195 TGGAGGGAAGAAGCAAGTGCAGG + Intronic
1069933615 10:71900286-71900308 TGAAGGGAAGGAGCCAGTCCTGG - Intergenic
1070820263 10:79350186-79350208 GGAAGGGAAGCCCCAAGTCCTGG - Intronic
1070914992 10:80147864-80147886 TGAAGGAAAGGACCCAGTCTTGG + Intergenic
1071197148 10:83175052-83175074 TAAAAGGAAGAACACAGTCCTGG - Intergenic
1071211696 10:83348794-83348816 TGAAGGAAAGGACCCAGTGCTGG + Intergenic
1071215291 10:83393871-83393893 TGAAGGGAAGAACCCAATCATGG - Intergenic
1071896768 10:90076235-90076257 TGAAGGGAAGAACCTACTCCTGG - Intergenic
1071935547 10:90526484-90526506 TGAAGGGAAGGACCCAGACATGG - Intergenic
1072296669 10:94015010-94015032 TGAAGTGAAGATTCAAATCCAGG - Intronic
1072396708 10:95050353-95050375 TGAAGGGAAGGACACAGGCCTGG + Intronic
1073678817 10:105679731-105679753 TGTAGGGAAGGACTCAGTCCTGG + Intergenic
1073708222 10:106010920-106010942 TGAAGGGAAGGACACAGTCCAGG - Intergenic
1073823422 10:107291633-107291655 TGAAGGGAAGGACCCAGTTCTGG - Intergenic
1074305247 10:112270985-112271007 TTAAGGGAAGAACCAAAACGGGG + Intergenic
1074638138 10:115344859-115344881 TGAAGGAAAGGACCCAGTCCTGG - Intronic
1075194955 10:120348344-120348366 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
1075830556 10:125407480-125407502 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
1076103169 10:127798508-127798530 AGAAGTGAAGACCCAAGTGCGGG - Intergenic
1076376795 10:129993737-129993759 TGAAGGGAAGGACCCTGTCCTGG + Intergenic
1076570253 10:131428061-131428083 TGAATGGATGGACCAGGTCCGGG - Intergenic
1076621328 10:131790084-131790106 TGAAGGGCTGAGCCAAGCCCTGG - Intergenic
1076994973 11:293390-293412 GGATGGGAAGACCCAGGTCCTGG - Exonic
1077740385 11:4839609-4839631 TGAAGGGAAGGACCTAGTCCTGG + Intronic
1077970232 11:7181651-7181673 TGAAGGAAATGACCCAGTCCTGG + Intergenic
1078244622 11:9563061-9563083 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1078350825 11:10591757-10591779 TGAGGGAAAGGGCCAAGTCCTGG - Intronic
1078816261 11:14825151-14825173 TGAAAGGAAGAACCATTACCAGG + Intronic
1078843105 11:15097149-15097171 TGAAGGGAAAGACCTAGTCCTGG - Intergenic
1078992613 11:16664969-16664991 TGAAGGTAAGGACCCAGTCTTGG + Intronic
1079037897 11:17036704-17036726 TGAAGGGAAGGACTCAGTGCTGG + Intergenic
1079183475 11:18214919-18214941 TGAAAAGAAAAACCCAGTCCTGG + Intronic
1079258307 11:18852347-18852369 TGAAGGGAAAAACCTAGTCCTGG + Intergenic
1079416203 11:20238607-20238629 TGAAGAGAAAGACCCAGTCCTGG - Intergenic
1079558697 11:21794178-21794200 TGAAGAGAAGGACCCAGTTCTGG - Intergenic
1079571636 11:21951116-21951138 TAAACGGAAGAACAAAGTCTTGG - Intergenic
1079571948 11:21953607-21953629 TGAAGGGAAGGACACAGGCCTGG + Intergenic
1079712932 11:23708730-23708752 TTAAGGGAAGAACACAGGCCTGG + Intergenic
1080213601 11:29816666-29816688 TGAAGGAAAGAACACAGACCTGG - Intergenic
1081049141 11:38315782-38315804 TGAAGGGAAGGACTCAGTCCTGG + Intergenic
1082195379 11:49298408-49298430 TGAAGAAAAGGACCCAGTCCTGG - Intergenic
1082721262 11:56679789-56679811 TGAAGGAAAGAACCCAGTCCTGG + Intergenic
1083071911 11:59993484-59993506 TGAAGGGAAGGATGCAGTCCTGG - Intergenic
1084099315 11:66935143-66935165 TGAAGGAAAGAACCATTTCTTGG + Intronic
1084763882 11:71294906-71294928 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
1085008214 11:73114658-73114680 TGAAGAGAAGGATCCAGTCCTGG - Intronic
1085147289 11:74212766-74212788 TGAAGGGAAGGACCCAGTCCTGG + Intronic
1085178413 11:74511035-74511057 TGAAGAGAAGGACCCAGTCCTGG + Intronic
1085179445 11:74521168-74521190 TGAAAGGAAGAAGGATGTCCGGG + Intronic
1085223413 11:74895834-74895856 TCAAGGGAAGGACTCAGTCCTGG + Intronic
1085223434 11:74895943-74895965 TGAAGGGAAGGACCTAGTACTGG + Intronic
1085372223 11:76019892-76019914 TGAAGGGAAGGACACAATCCTGG - Intronic
1085372320 11:76020457-76020479 TAAAAGGAAGGACCAAGTCCTGG - Intronic
1086033065 11:82383768-82383790 TGAAGGGAAGGACCCAGTCTTGG + Intergenic
1086068843 11:82776440-82776462 TGAAGGGAAGAACACAGGCCTGG + Intergenic
1086249757 11:84798798-84798820 TGAAGGGAAGGATGTAGTCCTGG - Intronic
1086261542 11:84946438-84946460 TGAAGGGAATAACACAGTCCTGG - Intronic
1086468221 11:87076759-87076781 TGAAGGAAAGCACCCAGTACTGG - Intronic
1086524579 11:87710770-87710792 TGAATGGAAGGATCCAGTCCTGG + Intergenic
1086660554 11:89411144-89411166 TGAAGAGAAGGACCCAGTCCTGG + Intronic
1086811279 11:91313345-91313367 TGAGGGCAAGAACCGGGTCCTGG - Intergenic
1087032050 11:93715709-93715731 TCAAGGGAAGGACCCAGTCCTGG - Intronic
1087178668 11:95120392-95120414 TGAAGGGAAGGACCTAGTCCTGG - Intronic
1087299282 11:96413541-96413563 TGAAGGGAAGGACCCAGACCTGG + Intronic
1087313409 11:96577377-96577399 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
1087350062 11:97020152-97020174 TAAAGGGAAGGACCCAGTCCTGG + Intergenic
1087380471 11:97398860-97398882 TGAAGGGAAGGACCCCTTCCTGG - Intergenic
1087402421 11:97684373-97684395 TGAAGGGAAGGAACCAGTCCTGG - Intergenic
1087417165 11:97871792-97871814 TGAAGGGAAGAATGAAGTTCTGG - Intergenic
1087473011 11:98601076-98601098 TGAAGGGAAGCACCCAGTCCTGG - Intergenic
1087498194 11:98917387-98917409 TGAAGGGAAGGACCCAGTTCTGG - Intergenic
1087598396 11:100283153-100283175 TGAAGGGAAAGACCCAGTCTTGG - Intronic
1087721003 11:101665332-101665354 TGAAGGGAATGACCCAGACCTGG - Intronic
1087876919 11:103369734-103369756 TGAAGGGAAGTACCCAATCCTGG + Intronic
1087877025 11:103370405-103370427 TGAAGGGAAGGACACAGGCCTGG + Intronic
1087887549 11:103497732-103497754 TGAAGGGAAGGACTCACTCCTGG + Intergenic
1087950735 11:104218303-104218325 TGAAGGGAAGAACATAAGCCTGG - Intergenic
1088009796 11:104986245-104986267 TAAAGGGAAGGATCCAGTCCTGG + Intergenic
1088046414 11:105457601-105457623 TGAATGGAATAACCCAGTCATGG + Intergenic
1088361940 11:109000778-109000800 TGAAGGGAAGGACATAGGCCTGG - Intergenic
1088362048 11:109001443-109001465 TGAAGGGAAGGACCCAATTCTGG - Intergenic
1088375814 11:109140706-109140728 TGAAGAAAAGGACCCAGTCCTGG - Intergenic
1088411552 11:109539802-109539824 TGAAGGGAGGGACCCAGTCTTGG - Intergenic
1088960819 11:114662818-114662840 CGAAGGAAAGGACCCAGTCCTGG + Intergenic
1089015766 11:115163987-115164009 TGCAGGGAGGCACCAAGTCAAGG + Intergenic
1089762228 11:120736161-120736183 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1089824672 11:121264558-121264580 TGATGGGAAGAAGCTGGTCCTGG - Intergenic
1089881207 11:121775422-121775444 TGAAGGGAGGATTCACGTCCAGG + Intergenic
1090111187 11:123911071-123911093 TGAAGGAAAAGACCCAGTCCTGG + Intergenic
1090136388 11:124203852-124203874 TAAAGGAAAGGACCCAGTCCTGG - Intergenic
1090210401 11:124916955-124916977 TGAAGGGAATGACCCAGTCCTGG - Intergenic
1090318208 11:125816779-125816801 TGAAGGGAAAAACACAGGCCTGG - Intergenic
1091275879 11:134349847-134349869 TGAAGCGAAGGACCCAGTCCTGG - Intronic
1091741741 12:2964237-2964259 GGAAGGGGAAGACCAAGTCCTGG - Intronic
1091967216 12:4754821-4754843 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1092497610 12:9012396-9012418 TGAAAGGAAGGACCCAGTCCAGG + Intergenic
1093124587 12:15313369-15313391 TGAAGAAAAGGATCAAGTCCTGG - Intronic
1093321296 12:17718516-17718538 TGAAGGGAAGGACCCATTTCTGG - Intergenic
1093419950 12:18964170-18964192 TGAAGGGAAGAACACAAGCCTGG - Intergenic
1093420053 12:18964832-18964854 TAAAGGGAAGGACCCAGCCCTGG - Intergenic
1093531806 12:20174691-20174713 TGAAGGGCAGAAACCAGTACTGG - Intergenic
1093538170 12:20247846-20247868 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
1093588639 12:20872662-20872684 TGAAGGGAAGGACCCACTCCTGG - Intronic
1093991077 12:25590844-25590866 TGAAGGGAGGGACCTAATCCTGG + Intronic
1093991204 12:25591595-25591617 TGAAGGGAAGGACACAGGCCTGG + Intronic
1094658219 12:32441371-32441393 TGAAGGAAAGGACCCAGTCCTGG - Intronic
1094741655 12:33296442-33296464 TGAAGGAAAGGACTCAGTCCTGG + Intergenic
1094817560 12:34203159-34203181 TGAAGGAAAGAACCCAGTGCTGG + Intergenic
1095099549 12:38166156-38166178 TAAAGGAAAGAACCCAGTGCTGG - Intergenic
1095227493 12:39695020-39695042 TGAAGGGAAGGACCCAATCCTGG + Intronic
1095227621 12:39695686-39695708 TGAAGGGAAGGACACAGGCCTGG + Intronic
1095625075 12:44304731-44304753 TGAAGGGAAGGACTCAGTCCTGG + Intronic
1095860230 12:46908358-46908380 TGAAAAGAAGAAACCAGTCCTGG + Intergenic
1097426064 12:59446127-59446149 TGAAGAGAAGAACCTAGTCCTGG - Intergenic
1097473158 12:60021209-60021231 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1097508599 12:60507496-60507518 TGAAGGGAATGACCCTGTCCTGG + Intergenic
1097791316 12:63818223-63818245 TGAAGGAAAGGATCCAGTCCTGG + Intergenic
1098046681 12:66408118-66408140 TGAAGGGAAGGACCCAGTCCTGG + Intronic
1098060290 12:66554312-66554334 TGAAGGGAAGAATCCAATTCTGG + Intronic
1098207949 12:68132822-68132844 TGAAAAGAAGAACCCAGCCCTGG - Intergenic
1098395279 12:70010767-70010789 TGAAGGGAAGGATTTAGTCCTGG + Intergenic
1098405663 12:70123497-70123519 TGAATGGAAGGACACAGTCCTGG + Intergenic
1098492053 12:71093245-71093267 TGAAGGAAAGGACCCAGTCCTGG - Intronic
1098503907 12:71226935-71226957 TGAAGGGAAGAGCCCAGTCCTGG + Intronic
1098705584 12:73685004-73685026 TGAAGGAAAGGACCCAGACCTGG + Intergenic
1098975346 12:76896322-76896344 TGATGGGATGGACCCAGTCCTGG + Intergenic
1099100921 12:78439542-78439564 TGAAGGGAAGAACTCAGTCCTGG - Intergenic
1099433750 12:82619489-82619511 TAAAGGGAAGGACCAAGTCCTGG + Intergenic
1099433863 12:82620145-82620167 TGAAGGGAAGGACATAGGCCTGG + Intergenic
1099524756 12:83705627-83705649 TGAAGGAAAAGACCCAGTCCTGG + Intergenic
1099564835 12:84230214-84230236 TAAAGGGAAGAACACAGGCCTGG - Intergenic
1099564950 12:84230875-84230897 CGAAGGGAAGGACGCAGTCCTGG - Intergenic
1099589636 12:84570778-84570800 TCCAGGGAATAGCCAAGTCCAGG - Intergenic
1099764180 12:86961051-86961073 TGAAGGGAAAGACCTAGTCTTGG - Intergenic
1099781646 12:87202831-87202853 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
1099882216 12:88480444-88480466 TGAAGGAAAGAACCTATTCCTGG + Intergenic
1100061046 12:90575848-90575870 TGAAGGGAAGGACTCATTCCTGG - Intergenic
1100360831 12:93878078-93878100 TGAAGGAAAGGACCCAGTCCTGG - Intronic
1100372032 12:93977101-93977123 TGAAGGCAAGAACCAAATCCGGG - Intergenic
1100381194 12:94063339-94063361 TGAAGGAAATGACCCAGTCCTGG + Intergenic
1100904883 12:99286323-99286345 TGAAGGGAAGGACCCAGTCCTGG + Intronic
1100946375 12:99788389-99788411 TGAAGGAAAGAACCCAGTCCTGG + Intronic
1100996007 12:100301985-100302007 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1101226638 12:102694300-102694322 TGAAAAGAAGAACCCAGTCCTGG + Intergenic
1101252014 12:102945983-102946005 TGAAGTGAAGGACCCAGTCATGG - Intronic
1102317916 12:111904899-111904921 TGAAGGGAAGGACTAAGTTCTGG + Intergenic
1102645267 12:114399706-114399728 TTAAGGGAAAAAGCAATTCCTGG + Intronic
1104103175 12:125634649-125634671 TGAAGGAAAGGAGCCAGTCCTGG - Intronic
1105336306 13:19473269-19473291 TGAAGGGAAGGACACAGGCCTGG - Intronic
1105460387 13:20579878-20579900 TGAAGGAAAGAACCCAGCCATGG - Intronic
1105559066 13:21473484-21473506 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
1106350025 13:28921267-28921289 TGAAGGCAAGGACCCAGCCCTGG - Intronic
1106855363 13:33846331-33846353 TGAAGGGAAGAACCCAGCTCTGG - Intronic
1106895961 13:34302604-34302626 TGAAGAGAAGAACTCAGTCCTGG + Intergenic
1106901552 13:34359141-34359163 TGCAAGAAAGAAGCAAGTCCTGG + Intergenic
1106964101 13:35038590-35038612 TGAAGGAAAGGACCCAGTCTAGG - Intronic
1107109267 13:36678065-36678087 GGAAGAGAAAAAACAAGTCCTGG + Intronic
1107178084 13:37423002-37423024 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
1107552125 13:41487163-41487185 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1107720692 13:43245334-43245356 TGAAGGGAAGGTCCAAGTCAGGG - Intronic
1107774448 13:43823166-43823188 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1107808257 13:44174967-44174989 TGAAAGGAAGGACCCAGTCCTGG - Intergenic
1108137976 13:47385910-47385932 TGAAGGGAAGGACCCAATCCTGG + Intergenic
1108698636 13:52925237-52925259 TGAAGAGAGAAACCAGGTCCGGG - Intergenic
1108858013 13:54819836-54819858 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1108973007 13:56401196-56401218 TGAAGGGAAGAAGCCAGTCCTGG + Intergenic
1108997067 13:56747634-56747656 TTAAGGGAAAGACCCAGTCCAGG - Intergenic
1109022757 13:57119269-57119291 TGAAGGGAAGGAACCAGTCCTGG - Intergenic
1109402802 13:61857453-61857475 TGAAGGGAAAGACCCAGTCTTGG - Intergenic
1109506718 13:63311652-63311674 AGAAGGGAAGAACCCATTCCTGG + Intergenic
1109522775 13:63534353-63534375 TGAAGGAAAGGACAAAGTTCTGG + Intergenic
1109685814 13:65818698-65818720 TGAGCGGAAGGACCCAGTCCTGG + Intergenic
1109747625 13:66647467-66647489 TGAAGGGAAGGACCCAGTCCTGG + Intronic
1109961674 13:69639437-69639459 TGAAGGGAAGGATCAAGTCCTGG - Intergenic
1110376713 13:74802577-74802599 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1110501272 13:76231263-76231285 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1111085837 13:83374094-83374116 TGAAAGGAAGAATCCAGTCCTGG - Intergenic
1111303424 13:86374031-86374053 TGAAGGGAAAGACCCAGGCCTGG - Intergenic
1111449102 13:88390858-88390880 TGAAGGGAAGGACTCAGTCCTGG + Intergenic
1112053827 13:95671468-95671490 TAAAGGGAAGTACCCAGTCCTGG - Intergenic
1112658032 13:101473861-101473883 TGAAGAGAAGGACCCAGTGCTGG + Intronic
1112658099 13:101474226-101474248 TGAAGGGAGAGACCAAGGCCTGG + Intronic
1112658141 13:101474504-101474526 TGAAGGGAGGAACACAATCCTGG + Intronic
1113244313 13:108377524-108377546 TGAAGGGAAGGATCCAGTACCGG - Intergenic
1114072700 14:19127237-19127259 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
1114089557 14:19272735-19272757 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
1114406942 14:22465707-22465729 TGATGGGAAGACAAAAGTCCTGG + Intergenic
1114432177 14:22670997-22671019 TAAAGGGAAGGGCCCAGTCCTGG + Intergenic
1114688056 14:24553886-24553908 TGAAGGGAAGCACATAGGCCTGG - Intergenic
1114985167 14:28217624-28217646 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1115306939 14:31943503-31943525 TGATGAGAAGAAACAAGCCCAGG + Intergenic
1115381651 14:32746395-32746417 TGAAAGGAAGGTCCAAGTCCTGG - Intronic
1115620250 14:35134041-35134063 TGAAGGGAAGAACACAGGCCTGG - Intronic
1115620333 14:35134514-35134536 TGAAGGGAAGAACCCAATCATGG - Intronic
1115821082 14:37212651-37212673 TGAAGGGAAGGACATAGGCCTGG + Intronic
1115925164 14:38425229-38425251 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
1116087068 14:40254029-40254051 TGAAAGGAAGGACCCAGTCTGGG - Intergenic
1116114959 14:40635978-40636000 TGAAAGGAAAGACCAAGTCCTGG + Intergenic
1116275624 14:42827756-42827778 TGAAGGGAAGGACCCAGTCTTGG - Intergenic
1116354787 14:43914585-43914607 TGGAGCGAAGAACCCAGTTCTGG + Intergenic
1116458472 14:45145058-45145080 TGAAGGGAAGAACACAGTCCTGG - Intronic
1116481039 14:45391915-45391937 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
1116481161 14:45392581-45392603 TGAAGGGAAGAACACAAGCCTGG + Intergenic
1116930660 14:50687945-50687967 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1116991575 14:51282914-51282936 TGAATGAAGGAAACAAGTCCAGG - Intergenic
1117264954 14:54077031-54077053 TGAAGGAAAGGACCCAATCCTGG - Intergenic
1117384289 14:55195242-55195264 TGAAAGGAAGGACTCAGTCCTGG - Intergenic
1117418326 14:55518853-55518875 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
1117606171 14:57431174-57431196 TGAAGGAAAGGACCCAGTTCTGG + Intergenic
1117606288 14:57431821-57431843 TGAAGGGAAGGACAGAGGCCTGG + Intergenic
1117634669 14:57729464-57729486 TGAAGGGAAGGACTCAGTCTTGG - Intronic
1117795450 14:59388790-59388812 TGAAGGGAAGGACCCAGGCCTGG - Intergenic
1117843049 14:59880937-59880959 TGAAGGGAAGAACCCAATCCTGG - Intergenic
1117870742 14:60198028-60198050 TGAAGGGAAGGACCCAGTTCTGG + Intergenic
1117893242 14:60449948-60449970 TGAAGGGAAGGACCCAGTCCTGG + Intronic
1118034198 14:61849037-61849059 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
1118241183 14:64060373-64060395 CGAAGGGAAGGACCCAGCCCTGG - Intronic
1118539075 14:66802681-66802703 TGTAGGGAAGGATCCAGTCCTGG - Intronic
1118543527 14:66858438-66858460 TGAAGGGAAGGACTCAGTCCTGG + Intronic
1118566044 14:67142251-67142273 TGAAGGGAAATACCAATTACAGG + Intronic
1119229701 14:72970389-72970411 TGGAGGGAAGAGCCAAGGACAGG + Exonic
1119823999 14:77641997-77642019 TGCAGGGAAGAGCCAAGGGCGGG + Intergenic
1120100093 14:80435024-80435046 TGAAGGGAAGGACTCAGTCCTGG + Intergenic
1120275690 14:82370192-82370214 TGAAGGGATGGACCTAGTCCTGG + Intergenic
1120439693 14:84520648-84520670 TGAAGGGAAGGACCCAGACCTGG - Intergenic
1120647532 14:87091441-87091463 TGAAGGAAATACCCAACTCCAGG + Intergenic
1120697410 14:87659624-87659646 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1120808112 14:88775032-88775054 TGAAGGGAAGGACCTACTCCTGG + Intronic
1121375921 14:93410727-93410749 TGAAGGGAAAGACCCAGTCCTGG + Intronic
1121759798 14:96435321-96435343 TGAAGGAAAGGACCTAGTCTCGG - Intronic
1121955018 14:98205740-98205762 TGAAGGGCAGAAACCAGGCCAGG - Intergenic
1122050518 14:99056380-99056402 GGAAGGCTTGAACCAAGTCCTGG + Intergenic
1122996275 14:105266747-105266769 AGAAAGGAAGAACCAAGGCTGGG + Intronic
1123581916 15:21722962-21722984 GGAAGAGAAGAACAAAGCCCAGG + Intergenic
1123618565 15:22165562-22165584 GGAAGAGAAGAACAAAGCCCAGG + Intergenic
1124688179 15:31799822-31799844 TGAAGGGAAGCCCCATGTCCTGG - Intronic
1124844299 15:33275552-33275574 TGAAGGGAAGAACCCCGTCCTGG - Intergenic
1125277029 15:38004132-38004154 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
1125567191 15:40685666-40685688 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
1125878246 15:43168444-43168466 TGAAGAGAAAGACCATGTCCTGG - Intronic
1126015652 15:44347977-44347999 TGAAGGGAAGGACCTAGACCTGG + Intronic
1126183753 15:45810911-45810933 TGATGGGAAGGACTCAGTCCTGG + Intergenic
1126294906 15:47129313-47129335 TGAAGAGAAGAACACAGGCCTGG - Intergenic
1126295005 15:47129931-47129953 TGAAGGAAAGGAACCAGTCCTGG - Intergenic
1126377793 15:48013343-48013365 TGAAGGAGAGAACCAGGTCAGGG - Intergenic
1126489068 15:49216263-49216285 TGAAGAGAAGAACCCAGTCTTGG - Intronic
1126517539 15:49553489-49553511 TGAAGGGAAGGACACAGGCCTGG - Intronic
1126706842 15:51414063-51414085 TAAAGGGAAGGACCCAGTCTTGG + Intergenic
1126979863 15:54228581-54228603 TGAAGGGAAGAATCCAGTCCTGG - Intronic
1127022207 15:54760586-54760608 TGAAGGAAAGGATCCAGTCCTGG + Intergenic
1127034094 15:54895793-54895815 TAAAGGGAAGGACCCAGTCCTGG - Intergenic
1127121367 15:55774958-55774980 TGAAGGGAGGAGGAAAGTCCAGG - Intergenic
1127155791 15:56123291-56123313 TGATGGGAAGGACCCAGTCCTGG - Intronic
1127170875 15:56299811-56299833 TGAAGGAAAGGACCCAGTTCTGG + Intronic
1127971560 15:63966155-63966177 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1128901083 15:71423420-71423442 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1128966216 15:72061097-72061119 TGAAAGGAAAGACCCAGTCCTGG + Intronic
1129092355 15:73164652-73164674 TAAAGGGAATAACTAAGTCAAGG - Intronic
1129501035 15:76038029-76038051 TGAAGGGAAGGACCTATTCCTGG + Intronic
1129561725 15:76577619-76577641 TAAAGGGAAAGACCCAGTCCTGG + Intronic
1129642371 15:77393547-77393569 TGAAGGGAAGGACCCAGTCCTGG + Intronic
1129702383 15:77775280-77775302 TGTAGGGCAGAGCCAGGTCCAGG - Intronic
1129835560 15:78703225-78703247 TGAAGGAAAGAACCCAGTCCTGG - Intronic
1129961949 15:79694932-79694954 TGAATGGAAAAATCAAGTCTAGG - Intergenic
1130046585 15:80450503-80450525 TGAGGGAAAGAACCAACTCCTGG - Intronic
1130441168 15:83955640-83955662 TGAAGAGAAAGACCAAGTCCTGG - Intronic
1130511774 15:84595408-84595430 TGAAGGAAAGAACCCAGTCCTGG + Intergenic
1130846619 15:87753690-87753712 AGAAGGGAAGCACCATTTCCGGG - Intergenic
1131323547 15:91420994-91421016 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1131410653 15:92205099-92205121 TGAAGGAAAGGACCAAGACCTGG - Intergenic
1131713487 15:95081109-95081131 TGATGGGCAAAAACAAGTCCTGG + Intergenic
1131944891 15:97608971-97608993 TGAAGAGAAGAACCCAATCCTGG + Intergenic
1131950201 15:97673473-97673495 TGAAGGGAAGGACCTAGTCCTGG - Intergenic
1131959452 15:97773379-97773401 TAAAGGGAAGAACCCAGTACTGG - Intergenic
1132229039 15:100168218-100168240 TGACGGGAGGAACCACCTCCTGG + Intronic
1132230668 15:100181541-100181563 TGAAGGGAAGCACCCAGTCCTGG - Intronic
1132681149 16:1142307-1142329 TGAAAGGAAGAACCTAAGCCTGG + Intergenic
1134038154 16:11047991-11048013 TCAAGGGCAGAACCATGTGCCGG - Intronic
1134171968 16:11976322-11976344 TGATGAGAGGAACCCAGTCCGGG - Intronic
1134407071 16:13970029-13970051 TGAAGGGAGGGACCCAGTCCTGG - Intergenic
1135424190 16:22324220-22324242 TGTTGGGAAGAATCAAGGCCAGG + Intronic
1135879526 16:26240591-26240613 TGAAGGGAAGGCCCCAGTCCTGG + Intergenic
1137227176 16:46524441-46524463 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
1138638320 16:58362000-58362022 TGAAGGGAAGGACCCAGTCATGG - Intronic
1138806848 16:60100325-60100347 TGAAGGGAAGGACACAGTCTTGG - Intergenic
1139004951 16:62558908-62558930 TGAAGGAGAGGACCCAGTCCTGG - Intergenic
1139103845 16:63802177-63802199 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1139766801 16:69237489-69237511 GGGAGGGAAGAGCCAAGTCTGGG + Intronic
1140158057 16:72454857-72454879 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1140158160 16:72455515-72455537 TGCAGTGAAGGACCCAGTCCTGG - Intergenic
1140171682 16:72611256-72611278 TGAATGAAAGAAAGAAGTCCTGG + Intergenic
1141485109 16:84333751-84333773 TGAAGAGAAGGACCTAGTCCTGG + Intergenic
1142919229 17:3169895-3169917 TGAAGGGAAGAACTCAGTCCTGG + Intergenic
1143347500 17:6260791-6260813 TGAAGGGAAGAACCATGGAGAGG + Intergenic
1143413673 17:6729000-6729022 CGAAGGGAAGGACCCAATCCTGG + Intergenic
1143722310 17:8821704-8821726 TGAAGGCAGTCACCAAGTCCTGG + Intronic
1144004105 17:11084475-11084497 TGAAGGGGAAAACGAAGCCCAGG + Intergenic
1145001542 17:19308560-19308582 GGAGGGGAAGGACCAGGTCCGGG + Intronic
1145117486 17:20225015-20225037 TGAAAGGAAGGACCCAGTCCTGG - Intronic
1146615123 17:34350422-34350444 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1146749894 17:35368915-35368937 TAAAGGGAAAGACCCAGTCCTGG + Intronic
1148650699 17:49248246-49248268 TGAAGAGGAGAACGATGTCCAGG + Intergenic
1148807051 17:50269207-50269229 TTGAAGGAAGATCCAAGTCCAGG + Intergenic
1149231262 17:54536980-54537002 TGAAGGGAAGTACCCAGTCCTGG + Intergenic
1149234866 17:54578083-54578105 TGAAGGAAAGGACTCAGTCCTGG + Intergenic
1149239767 17:54635472-54635494 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
1149249258 17:54749451-54749473 TGAAGGGAAGGAGCCACTCCTGG - Intergenic
1149386963 17:56151852-56151874 TCAAGGGAAGATTCAAGTCAAGG - Intronic
1149621294 17:58047154-58047176 TGAAGGCAAGAACAGAGGCCTGG - Intergenic
1150192613 17:63259051-63259073 TGAAAGGAAGGACCCAGTACTGG - Intronic
1151224923 17:72640738-72640760 GGAAGGGAAGAGACAAGACCTGG + Intergenic
1151603668 17:75122847-75122869 TGAAGGAAAGAAGCAAAGCCTGG + Intronic
1151691065 17:75685761-75685783 TGAAGGGAAAAAGCCTGTCCTGG + Intronic
1151699487 17:75735704-75735726 AGAAGGTAAGAAATAAGTCCAGG - Intronic
1153074629 18:1148438-1148460 TGAAGGGAAGGATCCAGTCCTGG + Intergenic
1153075341 18:1156226-1156248 TGAAGGGAAGGATCCAGTCCTGG - Intergenic
1153356631 18:4143844-4143866 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1153363284 18:4224108-4224130 TGAGTGGAAGAACTCAGTCCTGG + Intronic
1153389233 18:4535115-4535137 TGAAGGGAATGACCCAGTCCTGG - Intergenic
1153453847 18:5259458-5259480 TGAAGGGAAGGATCCAGTCCTGG + Intergenic
1153453916 18:5259894-5259916 TGAAGAGAAGAACACAGGCCTGG + Intergenic
1153715081 18:7839415-7839437 TGAAGTGAAGGACCTAGTCCTGG - Intronic
1154230750 18:12553674-12553696 TGAAGGGAAGGACAAGGGCCTGG + Intronic
1154386553 18:13897793-13897815 TGAAGGGAAGGAACCAGTTCTGG + Intronic
1154491111 18:14923029-14923051 TGAAGGGAAGAGCTCAGTCTTGG + Intergenic
1154505693 18:15038797-15038819 TCAAGGGCAGAACCAAGTAGAGG - Intergenic
1155282102 18:24250527-24250549 AGAAGGAAAGGACCCAGTCCTGG + Intronic
1155443372 18:25884956-25884978 TGAAGGAAACAACTCAGTCCTGG + Intergenic
1155597258 18:27502406-27502428 TTAAGAAAAGAACCCAGTCCTGG + Intergenic
1155782098 18:29849718-29849740 TGAAGGGAAGGATCTGGTCCTGG - Intergenic
1155792841 18:29996059-29996081 TGAAGGGAAGCACTGAGTCCTGG + Intergenic
1156025923 18:32655241-32655263 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1156026028 18:32655877-32655899 TGAAGAGAAGGAACCAGTCCTGG - Intergenic
1156055566 18:32998748-32998770 TGAAGGGAAGGACCTCATCCTGG + Intronic
1156094225 18:33510189-33510211 TAAAGAGAAGGACCCAGTCCTGG + Intergenic
1156726991 18:40140452-40140474 AGAAGGGAAGAAGCAGGCCCAGG + Intergenic
1156912407 18:42426271-42426293 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
1157022669 18:43805518-43805540 TGAAGGGAAGGACACAGTCCTGG - Intergenic
1157332587 18:46714478-46714500 TGAAGGGAGGAACGGAGTCTGGG + Intronic
1157619778 18:49009842-49009864 TTAAGAGAAGAAGCAAGTCATGG - Intergenic
1158116835 18:54005281-54005303 TGAAGGGAAGAAACCAGTCCTGG + Intergenic
1158481317 18:57824149-57824171 TGAAGGGGAGGACCCAGTCCTGG - Intergenic
1158897023 18:61923693-61923715 TGAAGGGATTAATCAAGTCATGG - Intergenic
1159080603 18:63731354-63731376 TGAAGGGAAGGACCAGTGCCTGG + Intergenic
1159092057 18:63860729-63860751 TGAAGCGAAGGACCCAGTCCTGG - Intergenic
1159284952 18:66336906-66336928 TGAAGGGAAGGACTAAGTCCTGG - Intergenic
1159446328 18:68545448-68545470 TGAATGGAAGGCCCCAGTCCTGG + Intergenic
1159564934 18:70037533-70037555 TGAAGGGAAGAAACCAGTCCTGG + Intronic
1159802607 18:72919820-72919842 TGAAGGAAAGGACCTAGTCTTGG - Intergenic
1160138431 18:76296022-76296044 TGAAGGGAAGGACCCACACCTGG - Intergenic
1160962235 19:1727641-1727663 TGAGGGGAAGCCCCAAGTCAAGG + Intergenic
1161081862 19:2314959-2314981 AGAAAGGAAGAACTAAGGCCAGG - Intronic
1162596118 19:11630561-11630583 TGAAAAGAAGGACCCAGTCCTGG + Intergenic
1163135196 19:15305582-15305604 TAAAGGGAAAAACAAAGTCTGGG - Intronic
1163185462 19:15636012-15636034 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1164297157 19:23922203-23922225 TGAAGGGCAGACCCAAGGGCAGG + Intronic
1164457046 19:28417658-28417680 TGAAGGGAAGGACAAAGGCCTGG - Intergenic
1164491161 19:28715258-28715280 TGAAGGGAAGGACACAGGCCTGG + Intergenic
1164698438 19:30264275-30264297 TGAAGGGAAGAGGGAACTCCAGG + Intronic
1165966720 19:39587455-39587477 TTAAAGCAAGAACCAAATCCTGG - Intergenic
1166016745 19:39986525-39986547 TGCAGTGAAGCACCAAGTCCTGG - Intronic
1166328192 19:42064003-42064025 TGAAGGCAAGGACCATTTCCAGG - Intronic
1166408368 19:42539869-42539891 TGAAGGAAAGGACCCAATCCTGG - Intronic
1166756123 19:45192644-45192666 TGAAGGAAATAGCCCAGTCCAGG - Intronic
1166757572 19:45202874-45202896 TGAAAGGAAGGACCCAGTCCTGG - Intronic
1167082996 19:47290057-47290079 TGAAGGTAAGGACCCAGTCCTGG + Intronic
1167084657 19:47301075-47301097 GGAAGGGAAGAAAAAAGGCCGGG - Intronic
1167400162 19:49261140-49261162 TGAAAGGAAGAACTCAGGCCGGG + Intergenic
1167582215 19:50351868-50351890 TGAAGGGAAGGATCCAGTCCTGG - Intronic
1168615461 19:57833759-57833781 TGAAGGGAAGAATTCAGTCATGG - Intronic
1168621324 19:57881688-57881710 TGAAGGGAAGAATTCAGTCATGG + Intronic
925269401 2:2591611-2591633 TGAAGGTGAGAACCAAGTCCTGG + Intergenic
925506363 2:4569318-4569340 TGAAGGGAAAGACCCAGTCCTGG - Intergenic
925506573 2:4572366-4572388 TGGAGGGAAGACACAAGCCCAGG - Intergenic
925588514 2:5487227-5487249 TGAAGGGAAGAATCTAGTCCTGG + Intergenic
925698971 2:6613789-6613811 GGAAAGGAAGGACCCAGTCCTGG - Intergenic
926518804 2:13883745-13883767 TGAAGGGAAGTAGCCATTCCTGG + Intergenic
926834181 2:16999259-16999281 TGAAGGGACAAACCCAGTCCTGG - Intergenic
927424995 2:22971406-22971428 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
927570304 2:24153418-24153440 TGAAGGGAAGGACCCAACCCTGG - Intronic
927594649 2:24385974-24385996 TGAAGGGAAGGACACAGGCCTGG - Intergenic
927759650 2:25741386-25741408 AGAAGCCAAGAACCAAGTCAGGG + Intronic
927861223 2:26561500-26561522 TGAAGGGAAGAAGCAAGACCTGG + Intergenic
927942602 2:27114589-27114611 TGAAGGGGAGAACCAGAACCAGG - Intronic
927966877 2:27275823-27275845 TGGAGGGAAGAAGCAAGTCCAGG + Intronic
928380509 2:30813817-30813839 TGAAGGAGAGAACCAAGGCCAGG + Intronic
928472180 2:31585574-31585596 TGAAGGGAAAGACCCAGTCATGG + Intergenic
928495668 2:31829181-31829203 CGAAGGGAAGGACCTAGTCCTGG - Intergenic
928715561 2:34056125-34056147 TGAAGAGAAGGACCAAATTCTGG - Intergenic
928767950 2:34670585-34670607 TGAAGTGAAGAACCTAGTCCTGG + Intergenic
928783662 2:34854988-34855010 TGAAGGGAAGGACATAGGCCTGG + Intergenic
928802885 2:35115600-35115622 TGAAGGGAAATACCCAGTCCTGG + Intergenic
928834731 2:35530022-35530044 TGAAGGGAAAGACCTAGTCCTGG - Intergenic
928932305 2:36637066-36637088 TGAAAGGAAGGACCCAGTCTTGG + Intronic
929029465 2:37637016-37637038 TTAAGGGAAGACTAAAGTCCTGG + Intergenic
929099967 2:38302106-38302128 TGAGGGGTATGACCAAGTCCTGG + Intronic
929215104 2:39403998-39404020 TGAAGGGAAGAACCCAGTTCAGG + Intronic
929388569 2:41441903-41441925 TGAAGGGAAGAACACAGGCGTGG - Intergenic
929529262 2:42736851-42736873 TGAAGGGAAGGATCCAGTCCTGG - Intronic
929787168 2:45001310-45001332 GGAAGGGAAGAAGGAACTCCTGG - Intergenic
929926579 2:46217296-46217318 TGAAGGAAAGAACCAAGTCCTGG - Intergenic
930159304 2:48137961-48137983 TGAAGGGAAGGACATAGGCCTGG + Intergenic
930439697 2:51390644-51390666 TGAAGAAAAGGACCCAGTCCAGG - Intergenic
930475432 2:51875738-51875760 TTAAGGGAAGGACCCAGTTCTGG + Intergenic
930492421 2:52092764-52092786 TGAAGGGAAGAACACAAGCCTGG - Intergenic
930727374 2:54695144-54695166 TGAAGGAAAGGAACCAGTCCTGG + Intergenic
930778238 2:55196611-55196633 TGAAAGGAAGGACCCAATCCTGG + Intronic
930944916 2:57061785-57061807 TTAAGGGAAGGACCCAGTCATGG - Intergenic
930947404 2:57092186-57092208 TGAAGGGAAGAACACAGTCTTGG - Intergenic
930947498 2:57092821-57092843 TGAAGGGAAGCATCCAGTCATGG - Intergenic
930971322 2:57398241-57398263 TGAAGGAAAGAACGCAGTCCCGG - Intergenic
930981177 2:57528210-57528232 TGAAGGGAAGGACTCAGCCCTGG - Intergenic
931358134 2:61554884-61554906 TGGATGGATGAATCAAGTCCAGG - Intergenic
931572237 2:63680962-63680984 TGAAAGGAAGGACCTAGTCCTGG + Intronic
931572349 2:63681618-63681640 TGAAGGGAAGGACACAGGCCTGG + Intronic
931600882 2:64001593-64001615 TGAAGGGAGGGACCCAGTCCTGG - Intronic
931637350 2:64352368-64352390 TGAAGGGAAGGACACAGGCCTGG + Intergenic
932422306 2:71608409-71608431 GGCAGGGAAGAAGCATGTCCTGG + Intronic
932648824 2:73532952-73532974 TGCAGGGAAGGACCCAGTCCTGG - Intronic
933097882 2:78210670-78210692 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
933162843 2:79044947-79044969 TGAAGGGAATTACTCAGTCCAGG + Intergenic
933162940 2:79045606-79045628 TGAAGTGAAGGACACAGTCCTGG + Intergenic
933317004 2:80727396-80727418 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
933387824 2:81634147-81634169 TGAAAGAAAGGACCAAGTCCTGG + Intergenic
934578367 2:95417660-95417682 TGAAGGGAACAACCATGGTCAGG + Intergenic
934601069 2:95659043-95659065 TGAAGGGAACAACCATGGTCAGG - Intergenic
935078653 2:99770710-99770732 TGAAGGGAAGGACCAAGTCCTGG - Intronic
935437887 2:103056314-103056336 TGAAAGGAAGGACCCAGTTCTGG - Intergenic
935576601 2:104717638-104717660 TGAAGGGAAGGACCTAGTCTTGG - Intergenic
935750931 2:106233131-106233153 TGAAGGGAAGAACCTATTCCTGG + Intergenic
935924397 2:108051796-108051818 TGAAGATAAGAACTAAGTCTTGG - Intergenic
935928263 2:108093745-108093767 TGAAGGGAAGAATCCAGTCCTGG - Intergenic
935989399 2:108705660-108705682 TGAAGGGAAGAACCCAGTCCTGG + Intergenic
936230447 2:110695703-110695725 GGAAGAGAAGATCCAAGTCAAGG + Intergenic
936511316 2:113149825-113149847 TGAAGGGAAGGACCTAGTCCTGG - Intergenic
936901365 2:117485207-117485229 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
936940422 2:117878707-117878729 TGAAGGGAAGAACCCAATCCTGG - Intergenic
937538068 2:122915505-122915527 TGAAGGCAAGAACAGATTCCAGG + Intergenic
937590959 2:123612755-123612777 TGAAGGGAATGACCCAGTCCTGG + Intergenic
937591200 2:123615066-123615088 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
937798192 2:126050542-126050564 TGAAGCTAAAAACCAAGTTCAGG + Intergenic
938216965 2:129526292-129526314 TGAAGGGAAGAGCCCAGTTCTGG + Intergenic
939244839 2:139610072-139610094 TGAAGGGAAGCACCCAGTCCTGG - Intergenic
939443228 2:142276127-142276149 TGAAGGGAAGGACTTACTCCTGG - Intergenic
939526301 2:143299049-143299071 TGAAAGGAAGGACCCAGTGCTGG - Intronic
939800510 2:146701011-146701033 TGAAGGGAAGGACACAGGCCTGG + Intergenic
939930795 2:148230774-148230796 TGAACGGAAGAACCCAGTCCTGG - Intronic
940167213 2:150787391-150787413 AGGAGGGAGGAACAAAGTCCAGG + Intergenic
940315195 2:152320730-152320752 TGAAGGGAAGGACCCAGTCTTGG - Intergenic
940429784 2:153575975-153575997 TGAAGGGAAGGAAACAGTCCTGG - Intergenic
940443969 2:153754412-153754434 TGAAGGGAAGGATCCAGTCCTGG - Intergenic
940503698 2:154526941-154526963 TGAAAGGAAGGACAAAGGCCTGG - Intergenic
940546890 2:155100323-155100345 TGAAGGGAAGTACTCAGTCCTGG + Intergenic
940947709 2:159636964-159636986 TCAAGGGAAGGACCTAGTCCTGG + Intergenic
941303340 2:163830320-163830342 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
941357474 2:164511527-164511549 TGAAGGGAAAAACCTAGTCCTGG + Intronic
941672605 2:168310846-168310868 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
942208479 2:173647346-173647368 GGAACGTAAGAGCCAAGTCCAGG + Intergenic
942304289 2:174590505-174590527 CCAAGGGAAGAACCAAATGCTGG - Intronic
942352285 2:175065342-175065364 TGAAAGGAAGGACCCAGTCCTGG + Intergenic
942391706 2:175502181-175502203 TGAAGGGAAGAACACAAACCTGG - Intergenic
942734745 2:179097025-179097047 TGAAGGGAAGGACCCAGTACTGG - Intergenic
942862759 2:180635957-180635979 TGAAGGAAAGGCCCCAGTCCTGG + Intergenic
942972288 2:181971295-181971317 TGAAGGGATGGACCCAGTCCTGG - Intronic
943067652 2:183105668-183105690 TGAAAGGAAGAACCCAGTCGTGG - Intergenic
943099552 2:183471651-183471673 TAAAGGGAAAAACCAAGTCCTGG - Intergenic
943117526 2:183691864-183691886 TGAAGGCAAGGACCCAGTCTTGG - Intergenic
943118981 2:183710468-183710490 TGAAGGATAGGACCTAGTCCTGG - Intergenic
943208233 2:184928205-184928227 TGAAGGGAAGGACCTAGTTTTGG - Intronic
943226803 2:185188255-185188277 TGAAGGGAAGGAACTAGTCCTGG - Intergenic
943237265 2:185338266-185338288 GAAAGGGAAAAACCTAGTCCTGG - Intergenic
943455474 2:188102531-188102553 TGAAGGGAAGACACAAATGCTGG + Intergenic
943484733 2:188465236-188465258 TGAAGGGAAGAACTCAGTCATGG - Intronic
943756590 2:191563587-191563609 GGCTGGGAAGAGCCAAGTCCAGG - Intergenic
943845081 2:192635050-192635072 TGAAGGGAAGGACCAAGTCCTGG + Intergenic
944046140 2:195413985-195414007 TGAAGGGAAGGACCCAGGCCTGG + Intergenic
944078565 2:195759314-195759336 TGAAGGGAAGTGCCCACTCCTGG + Intronic
944095960 2:195968336-195968358 TGAAGGGAAGGACACAATCCTGG - Intronic
944113523 2:196161878-196161900 TTAAGGGCAGAGGCAAGTCCTGG - Intronic
944287265 2:197966002-197966024 TGAAGGGAAGAACCCAGTCCTGG - Intronic
944616367 2:201464964-201464986 TGAAGGGAGAAACCCAGGCCTGG - Intronic
944616440 2:201465322-201465344 TGAAGGGAAGGACCTAGTTCTGG - Intronic
944760130 2:202806370-202806392 TAAAGGGAAGGACCCAGTCCTGG + Intronic
944760345 2:202807890-202807912 TAAAGGGAAGGACCCAGTCCTGG + Intronic
944855113 2:203759936-203759958 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
944955049 2:204798806-204798828 TGAAGGGAAGGATCCAGTCCTGG + Intronic
944963398 2:204901823-204901845 TGAAGGGAAAAACCCAGTCCTGG - Intronic
944990548 2:205230359-205230381 TGAAGGGGAGAACCCAGACCTGG - Intronic
945575632 2:211525462-211525484 TGAAAGGAAAGACCTAGTCCTGG + Intronic
945575741 2:211526031-211526053 TGAAGGGAAGAACATAAGCCTGG + Intronic
945713677 2:213331304-213331326 TGAAGGGAAGAACCTGATCTTGG + Intronic
945771249 2:214045311-214045333 TGAAGGGAAAGACCCAGTCCTGG + Intronic
945803770 2:214465360-214465382 TGAAGGGAAGGACCCAGTCCTGG - Intronic
945895670 2:215478903-215478925 TAATGGGAAGAACAAAGTCAAGG - Intergenic
946170691 2:217893681-217893703 GGCAGGGAGGAACCAAGTCCTGG - Intronic
946509108 2:220335168-220335190 TGAAGGGAAGGACCCAATCCTGG - Intergenic
946945691 2:224819428-224819450 TTAAGGTAAGAACCACGTACAGG - Exonic
947312374 2:228818407-228818429 TGAAGGGAAGAACCCAATTCTGG - Intergenic
947439774 2:230109206-230109228 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
947980613 2:234405586-234405608 TGAAGGAAAGCACCTTGTCCGGG - Intergenic
948475524 2:238216553-238216575 TGAAGGGAAGGACCCAGTCTTGG - Intergenic
948483925 2:238268038-238268060 TGAAGGTAACAGCCAAGCCCAGG - Exonic
948774642 2:240277637-240277659 TGAAGGGAAGGATCCAGCCCTGG + Intergenic
1168741984 20:199954-199976 TGAAAGGAAGGACACAGTCCTGG - Intergenic
1168742095 20:200619-200641 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1168917256 20:1500331-1500353 TGAAGGAAAGATCCCACTCCTGG - Intergenic
1169587109 20:7097170-7097192 TGAAGGGAAGGACACAGGCCTGG + Intergenic
1169617996 20:7471561-7471583 TGATGGGAAGGACCTAGTCCTGG - Intergenic
1169623896 20:7540740-7540762 TGAAGGGAAGAACCAATGCCTGG + Intergenic
1169628302 20:7597361-7597383 TGAAGGGAAGGATGAAGTACTGG + Intergenic
1169628595 20:7600163-7600185 TGAAGGGAAGGACCTAGTCCTGG + Intergenic
1169780132 20:9300976-9300998 TGTGGGGAAGAACCCATTCCTGG + Intronic
1169816532 20:9662562-9662584 TGCAGAGAAGAACAAAGTGCAGG + Intronic
1170062740 20:12276405-12276427 TGAAGGAAAGGACCTAGTCCTGG + Intergenic
1170236012 20:14105892-14105914 TGAAGGAAAGGACCCAGTCCTGG + Intronic
1170512051 20:17087346-17087368 TGAAGGCAAGGACCAGGTCTTGG + Intergenic
1171937960 20:31293852-31293874 TGAAGGAAAAAACCCAGTCCTGG + Intergenic
1172203616 20:33146085-33146107 TGAAGGGAAGGAGCCAGTCCTGG - Intergenic
1172817913 20:37704070-37704092 TGAAGAAAAGAACCATGGCCGGG - Intronic
1173004196 20:39127139-39127161 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
1173204246 20:40980174-40980196 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
1173405345 20:42759561-42759583 TGAAGGAAAGCCCAAAGTCCTGG + Intronic
1174938511 20:54898277-54898299 TGAAGGGAATGACCCAGTTCTGG + Intergenic
1175761110 20:61562550-61562572 TGCAGGGACGCACCAAGTCTGGG - Intronic
1176792168 21:13330233-13330255 TCAAGGGCAGAACCAAGTAGAGG + Intergenic
1176899412 21:14420895-14420917 TGAAGGGAAGAACACAGGCCTGG + Intergenic
1176994985 21:15544521-15544543 TGCAGGGAAGGACCCACTCCTGG + Intergenic
1177023777 21:15896200-15896222 TGAAGGGAAGAGCCCAGTCTTGG + Intergenic
1177105155 21:16946059-16946081 TGAAGGGAAGGACCCAGTTCTGG + Intergenic
1177222256 21:18209751-18209773 TGAAGGGAAGAACCCAGTCCTGG - Intronic
1177275991 21:18913616-18913638 TGAAGGGAAGGACCCAATCCTGG - Intergenic
1177401020 21:20605619-20605641 TGAAGAAAAGAACCCAGTCCTGG + Intergenic
1177569672 21:22871092-22871114 TAAAGGAAAGAACCCAGTCTGGG - Intergenic
1177991562 21:28041216-28041238 TCAAGGGCAGAACCAAGTAGAGG + Intergenic
1178135693 21:29624940-29624962 AGAAGGGAAGAAGAAAGGCCTGG - Intronic
1178216687 21:30606379-30606401 TGAAGGGAAGGACACAGGCCTGG + Intergenic
1178238145 21:30867821-30867843 TGAAGGGAAGAACAAATTCCTGG + Intergenic
1179652476 21:42820621-42820643 TGAAGGGAAGGACTCAGTCTTGG + Intergenic
1180197370 21:46205950-46205972 GGGAGGGAAGAACCAAGTGTTGG + Intronic
1180491146 22:15849612-15849634 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
1180563248 22:16639369-16639391 TGAAGGGAAGGACACAGGCCTGG + Intergenic
1181716835 22:24737361-24737383 TGAAGGGAAGGACCCAGCCCAGG + Intronic
1181983308 22:26781818-26781840 TGAGGGGAAGCGCCAAGCCCTGG - Intergenic
1183531880 22:38360775-38360797 TGAAGGGAAGGACACAGGCCTGG - Intronic
1183614627 22:38936430-38936452 TGAAGGGCAGAGCCAGTTCCTGG + Intergenic
1184415495 22:44349672-44349694 TGAAGGTAAGACCCAAATGCAGG - Intergenic
1185049047 22:48544157-48544179 TGAAGGGAAGACCCCACCCCAGG - Intronic
949155956 3:827425-827447 TGAAGGAAAGAACACAGGCCTGG + Intergenic
949235727 3:1806300-1806322 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
949448563 3:4162034-4162056 TGAAAGAAAGGACCCAGTCCTGG - Intronic
949829288 3:8197048-8197070 TGAAGGGAAGGACCCAATTCAGG - Intergenic
950157453 3:10733580-10733602 TAAAGTGAACAACCAAGTGCTGG + Intergenic
950365130 3:12477739-12477761 CCAAGGTAAGAACCCAGTCCCGG - Intergenic
950648598 3:14393210-14393232 GGAAGGGAAGAGACAGGTCCAGG - Intergenic
950695671 3:14699479-14699501 TGAAGGGAAGGACCCAGTCCTGG - Intronic
950927803 3:16760115-16760137 TGAATGGAAGGACCCAGTCATGG - Intergenic
951029319 3:17863551-17863573 TGAAGGGAAGGACCTAGTCCTGG - Intronic
951032263 3:17895625-17895647 TGAAGGAAAGGACCCAATCCTGG - Intronic
951102292 3:18703167-18703189 TGAAGGGAAGGATCTAGTCCTGG + Intergenic
951129913 3:19029948-19029970 TGAAGGGAAGAACCTAGTCCTGG + Intergenic
951177821 3:19622669-19622691 TGAAGGGGAGGATCCAGTCCTGG - Intergenic
951204336 3:19909866-19909888 TGAAGGAAAGAACCCAATCCTGG + Intronic
951204455 3:19910535-19910557 TGAAGGGAAGGACACAGGCCTGG + Intronic
951259940 3:20495640-20495662 TGAAGGGAAGAGCCCAGTCCTGG - Intergenic
951279463 3:20731106-20731128 TGAAGGGAAGAACACAAGCCTGG - Intergenic
951392992 3:22130043-22130065 TGAAGAGAAGGACCCAGTTCTGG - Intronic
951423089 3:22510680-22510702 TGAAGAGAAGGACCCAGTACTGG + Intergenic
951437012 3:22676621-22676643 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
952066463 3:29577131-29577153 TGAAGGGAAGGACCTAGTCCTGG - Intronic
952132834 3:30384638-30384660 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
952139746 3:30465679-30465701 TGAAGGGAAGAACACAGGCCTGG - Intergenic
952312293 3:32201171-32201193 TGAAGGGGTGAACTTAGTCCAGG - Intergenic
952517925 3:34124552-34124574 TGAAGAGAAGGACCAAGTCCTGG - Intergenic
952811916 3:37411745-37411767 TGAAGGGAAGGACCCAGTCCTGG - Intronic
953695934 3:45159164-45159186 AGAAGGGAACAACCAATACCAGG - Intergenic
953722655 3:45369677-45369699 TGAAGGGAAGGACACAATCCTGG + Intergenic
954491626 3:50912502-50912524 TGAAGGGAAGGACACAGGCCTGG - Intronic
956549470 3:70441937-70441959 TGAAGGGAAGGACCTAGTCCTGG + Intergenic
957085755 3:75675154-75675176 TGAAGAAAAGAACCATGTGCTGG - Intergenic
957192258 3:77024588-77024610 TGAGGGAAATAACCAAGACCTGG + Intronic
957434388 3:80154821-80154843 TGAAGGGGAGGACCCAGACCTGG - Intergenic
957537923 3:81530882-81530904 TAAAGGGAAGGACCCAGGCCTGG - Intronic
957538032 3:81531553-81531575 TGAAGGGAAGAACTCAGTCCTGG - Intronic
957699232 3:83687599-83687621 TCAAGGGAAGGACCCAGCCCTGG - Intergenic
958072865 3:88637062-88637084 GGAAGGGAAGAACCTCTTCCTGG - Intergenic
958083384 3:88775056-88775078 TGAAAGGAAAAACTCAGTCCTGG + Intergenic
958670386 3:97197041-97197063 TGAAGGGAAGAATACAGGCCTGG - Intronic
958682797 3:97353065-97353087 TGAAGGGAAGGACCCAGTCCTGG + Intronic
958760143 3:98296809-98296831 TGAAGGGAAGAGCCCAGTCCTGG + Intergenic
958765908 3:98367776-98367798 TGATGGGATGAACCCAGTCCTGG - Intergenic
958876654 3:99624590-99624612 TGAAGGGAAGGACCCAATCCTGG + Intergenic
959015777 3:101132348-101132370 TGAAGAGAAGAAACATGGCCAGG - Intergenic
959042006 3:101432373-101432395 TGAAGGGAAGAACACAGGCCTGG + Intronic
959279230 3:104316823-104316845 TGAAGGAAAGTACCCAGTACTGG + Intergenic
959409082 3:105997866-105997888 TGAAGGGAAAAACCCAGTCCTGG - Intergenic
959413998 3:106061717-106061739 TGAAGGGAAGGACCCAGTTCTGG + Intergenic
959414105 3:106062349-106062371 TGAAGGGAAGGACACAGGCCTGG + Intergenic
959448313 3:106467483-106467505 TAAAGGGAAGGGCAAAGTCCTGG - Intergenic
959640167 3:108623395-108623417 TGAAGGTAAGAACCCAGTCCTGG - Intronic
959725055 3:109533465-109533487 TGAAGGAAAGGACCCAATCCTGG - Intergenic
959761870 3:109976075-109976097 TGAAGGGAAGAACACAGGTCTGG - Intergenic
959762021 3:109977062-109977084 TGAAGGAAAGGACTCAGTCCTGG - Intergenic
959806627 3:110562274-110562296 TGAAGAGAAGAACCCAGTCCTGG - Intergenic
959868456 3:111299622-111299644 TGAAGGGAAGGACGAAAGCCTGG - Intronic
960095409 3:113685412-113685434 TGAAGGGAGAGACCCAGTCCTGG - Intronic
960207343 3:114918591-114918613 TGAAGAGAAGGACCCAGCCCTGG - Intronic
960404118 3:117238612-117238634 TGAAGAGAAGGACCCAGTCTTGG + Intergenic
960471860 3:118075804-118075826 TGAAGGGAAGGACCCAGTCAAGG - Intergenic
960521193 3:118657826-118657848 TGAAGGAAAGGACCCAATCCTGG - Intergenic
960785025 3:121362961-121362983 TGAAGGAAAGAACCCAGTTCTGG - Intronic
961034774 3:123634746-123634768 AGCAAGGAAGTACCAAGTCCAGG + Intronic
961551976 3:127674521-127674543 TGAAGGGAGGAAGGAAGTACAGG - Intronic
961952275 3:130762391-130762413 TGAAGGGAAGGGCCCAGTCCTGG + Intergenic
962015132 3:131431513-131431535 TGAAGGGAAGAACCCAGTCTTGG + Intergenic
962106507 3:132395847-132395869 TGAAGGAAAGGACCCAGTGCTGG + Intergenic
962235704 3:133705345-133705367 GGAGGGAAAGAACCCAGTCCAGG - Intergenic
962483301 3:135816396-135816418 TGAAGGCAAAGACCCAGTCCTGG + Intergenic
962638826 3:137361716-137361738 TGAAAGGAAGGACCCAGTCCTGG - Intergenic
962688455 3:137869363-137869385 TGAAGGGAAGGACACAGGCCTGG + Intergenic
962699051 3:137979169-137979191 TAAAGGGAAGGACCCAGTCCTGG - Intergenic
962767557 3:138579636-138579658 TGGAGGGAAGGACCCAGTCCTGG + Intronic
962862654 3:139418988-139419010 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
962998335 3:140652849-140652871 TGAAGTTAAGAACCCAGTCCTGG + Intergenic
963020499 3:140868889-140868911 TAAAGGGAAGGACTCAGTCCTGG - Intergenic
963154100 3:142077597-142077619 TGAAGGGAAGGACCCAGTCCTGG + Intronic
963179405 3:142338377-142338399 TGAAGGGAAGAACCCAGTCCTGG + Intronic
963330515 3:143910053-143910075 TGAAGGGAAGGACCTAGTCCTGG + Intergenic
963459303 3:145587158-145587180 TAAAGGGACAAACCCAGTCCTGG + Intergenic
963515278 3:146301091-146301113 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
963516663 3:146317331-146317353 TGATAGGAACAATCAAGTCCAGG - Intergenic
963664876 3:148170118-148170140 TCAAAGAAAGACCCAAGTCCAGG - Intergenic
963701490 3:148631353-148631375 TGAAAGGAAAGACCCAGTCCTGG + Intergenic
963810901 3:149775377-149775399 TGTTGGAAAGAACCCAGTCCTGG + Intronic
964179374 3:153865286-153865308 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
964209215 3:154209812-154209834 TGAAGGGAAGGACACAGGCCTGG - Intronic
964209330 3:154210372-154210394 TGAAGAAAAGAACCCAGTCCTGG - Intronic
964239482 3:154574644-154574666 TGAAGGAAAGGACTCAGTCCTGG + Intergenic
964244261 3:154632962-154632984 TGAAGGGAAGGACCCAGTTCTGG - Intergenic
964349777 3:155791242-155791264 TGAAGAGAAGAACCCAGTCCTGG + Intronic
964582924 3:158260286-158260308 TGAAGGGGAAGACCTAGTCCTGG - Intronic
964758881 3:160114825-160114847 TGAAGGGAAGGACCCAGTCTTGG + Intergenic
964758991 3:160115490-160115512 TGAAGGGAAGGACACAGTCCTGG + Intergenic
964872244 3:161325868-161325890 GGTAGGGAACAACCAAGTACTGG + Intergenic
964936480 3:162094976-162094998 TGAAGGAAAGGACCCAGTACTGG - Intergenic
964976193 3:162623148-162623170 TGAAGAGAATAACTCAGTCCTGG - Intergenic
965047590 3:163598520-163598542 TGAAGGGAAAAACACAGGCCTGG + Intergenic
965118340 3:164520223-164520245 TGAAGGGAAGAATCCAGTCCTGG - Intergenic
965160699 3:165129531-165129553 TGAAGGGAAGGACTCAGTCTTGG - Intergenic
965209625 3:165768260-165768282 TGAAGGGAAGGACCAAGTCCTGG - Intergenic
965236917 3:166136403-166136425 TGAAGGAAAGGATCCAGTCCTGG - Intergenic
965253136 3:166368615-166368637 TGAAGAAAAGAACTCAGTCCTGG + Intergenic
965349991 3:167599964-167599986 TTAAGGAAAGGACCGAGTCCTGG - Intronic
965358676 3:167710004-167710026 TGAAGGGAAGGATCCAATCCTGG + Intronic
965415208 3:168384557-168384579 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
965860754 3:173146864-173146886 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
965867048 3:173217022-173217044 TAAAGGGAAGGACCCAGTCCTGG - Intergenic
965980279 3:174681609-174681631 TAAAGGGAAGAACCCAGTTCTGG + Intronic
966141922 3:176766880-176766902 TGAAAGGAAGGACCCAGTCCTGG + Intergenic
966151076 3:176868418-176868440 TGAAGGGAAAAACCCAGTCCTGG + Intergenic
966151142 3:176868783-176868805 TGAAGGGAAAAACCCAGGCCTGG + Intergenic
966313059 3:178615896-178615918 TGAAGGAAAGGAACCAGTCCTGG - Intronic
966329000 3:178790179-178790201 TGAAGGGAAGAAACTAGTCCAGG + Intronic
966348526 3:179004765-179004787 TGAAGGAAAGGACCCAGACCTGG + Intergenic
966400906 3:179546236-179546258 TGAAGGGAAGGACTCAGTCGTGG + Intergenic
966468232 3:180256425-180256447 TGAAGGAAATGACCCAGTCCTGG + Intergenic
966540654 3:181086273-181086295 TGAAGGGGAGAGCCGAGTTCAGG + Intergenic
967677453 3:192317011-192317033 TGAAGGGAAGGACCCAGTTCTGG + Intronic
967696990 3:192543738-192543760 TGAAGGGGAGAACCCAGTCCTGG - Intronic
967991817 3:195137155-195137177 TGAAGGGAAGAAAAAAGTGGAGG + Intronic
968005026 3:195236822-195236844 TGAAGGGAAGGACCCAGTAATGG - Intronic
968017996 3:195356746-195356768 TGAAGGGAAGGATCAAGTCCAGG + Intronic
968218552 3:196915487-196915509 TGAAGGGAAGGGCCCAGTCTTGG + Intronic
968429193 4:545269-545291 TTAAGGGAAAGACCCAGTCCTGG - Intergenic
969258009 4:6015715-6015737 TGAAGGGGAAATCCAATTCCTGG + Intergenic
970071236 4:12162176-12162198 TGAAGGAAAAGACCCAGTCCTGG - Intergenic
970097996 4:12486905-12486927 TGAAGGGAAAGACCCAGGCCTGG - Intergenic
970099238 4:12502328-12502350 TCATGGGAAGGACCAAGTCAGGG - Intergenic
970442439 4:16093374-16093396 TGAGGGGAAGAATCCAGTCCTGG + Intergenic
970667496 4:18354290-18354312 TGAAGGAAAGAATCCAGTTCTGG - Intergenic
970892830 4:21067171-21067193 TGAAGGGAAAAACCCAGTTCTGG + Intronic
971558748 4:28047325-28047347 TGAAGGGAAGTACTCAGTCCTGG - Intergenic
971567851 4:28168253-28168275 TGAAGGGAAGAGCCCAGTACTGG - Intergenic
971914593 4:32851441-32851463 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
972104075 4:35461184-35461206 TGAAGGGAAGGACATAGGCCTGG - Intergenic
972104175 4:35461852-35461874 TGAAAGGAAGGACCCAGTCCTGG - Intergenic
972125316 4:35758347-35758369 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
972207768 4:36798612-36798634 TGAAGGGAAGGACCAAATCTTGG + Intergenic
972271107 4:37511427-37511449 TGAAGGGAAGGACCCAGTTTAGG - Intronic
972278470 4:37581467-37581489 TGAAAGGAAGGACCAAGTCCTGG - Intronic
972468805 4:39384301-39384323 TGAGGGGAAGGACCCAGTTCTGG - Intergenic
972851573 4:43057173-43057195 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
972902394 4:43700802-43700824 TGAAGGAAAGAACCCAGTGCTGG - Intergenic
972904463 4:43728135-43728157 TGAAAGGAAGAATCTAGTCATGG + Intergenic
972909622 4:43798017-43798039 TGAAGGGAAGGACACAGGCCTGG + Intergenic
973255848 4:48112422-48112444 TGAAGAGAAGATCCAAGTCAAGG - Exonic
973287862 4:48439945-48439967 TGAAGAGAAGGACCTAGTCCTGG - Intergenic
973327464 4:48878022-48878044 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
973348524 4:49082821-49082843 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
973919835 4:55673746-55673768 TGAAGGGAGGAACCCAGTCATGG - Intergenic
974200989 4:58640280-58640302 TGAAGGGAAGGAGTAATTCCTGG - Intergenic
974224284 4:59018647-59018669 TGAAGGAAAATACCCAGTCCTGG - Intergenic
974267026 4:59598643-59598665 TGAAGGGAAGGACAAAAACCTGG + Intergenic
974309614 4:60187887-60187909 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
974353023 4:60774048-60774070 TGAAGAGAAGGACTCAGTCCTGG - Intergenic
974414999 4:61595388-61595410 TGAAGTGAAGAGCCCAGTCCTGG - Intronic
974475985 4:62380944-62380966 TTAAGGAAAGAACTAAGTCTTGG + Intergenic
974630256 4:64479706-64479728 TGAAGGGAAGGACACAGGCCTGG - Intergenic
974630364 4:64480364-64480386 TGAAGGAAAGAACCTAGTCCTGG - Intergenic
974867977 4:67603605-67603627 TGAAGGGAAGGACTCAGTCCTGG - Intronic
974893293 4:67907537-67907559 TGAAGGGAAGGACCCAGTTCTGG - Intergenic
975295230 4:72726773-72726795 GGAATGAAAGAACCCAGTCCTGG + Intergenic
975314264 4:72933330-72933352 TGAAGGAAAGGACCTAGTCCTGG - Intergenic
975503880 4:75117156-75117178 TGAAAGGAAGGACTCAGTCCTGG + Intergenic
975592813 4:76017300-76017322 TGAAGGGAAGGACCCACTGCTGG - Intronic
975629658 4:76387346-76387368 TGAAGGGAAGAACACAGTCCTGG + Intronic
976016389 4:80560233-80560255 TGAAGGAAAATACCCAGTCCTGG + Intronic
976254111 4:83083049-83083071 TGAAGGGAAGGACACAGGCCTGG - Intergenic
976722029 4:88178332-88178354 TGAAGGGAAAAACACAGTCCTGG + Intronic
976943775 4:90739193-90739215 TAAAGGGAAGGACCCAGTCCTGG - Intronic
977026819 4:91830580-91830602 TGAAGGAAAGCACCCATTCCTGG - Intergenic
977307434 4:95342431-95342453 TGAAGGGAAGGACCAAGTCCTGG + Intronic
977307548 4:95343101-95343123 TGGAGGGAAGAACAAAGGCCTGG + Intronic
977399131 4:96509782-96509804 TGAATGAAAGGACCCAGTCCTGG + Intergenic
977854776 4:101876112-101876134 TGAAGGAAAGGATCCAGTCCTGG + Intronic
978116101 4:105022167-105022189 TGAAGGGAAGGACCCACTGCTGG + Intergenic
978212685 4:106157071-106157093 TGAAGGGAAGGACTCAGTCCTGG - Intronic
978258263 4:106718729-106718751 TGAAGGGAAGGACCCATTCCTGG + Intergenic
978261707 4:106768073-106768095 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
978343090 4:107738173-107738195 TGAAGGAAAGACCCATGTCCTGG - Intergenic
978474560 4:109111254-109111276 TGAAGGCCAGAATCCAGTCCAGG + Intronic
978934639 4:114359715-114359737 TGAAGGGAATAAAGCAGTCCTGG - Intergenic
979073499 4:116241238-116241260 TGAAGGGAAGGATTCAGTCCTGG - Intergenic
979100271 4:116604017-116604039 TGAAAAGAAGGACCCAGTCCTGG - Intergenic
979111459 4:116762427-116762449 TGAAGGGAAGAAAAAAAGCCTGG + Intergenic
979184615 4:117772636-117772658 TGAAGGGAGGGATCCAGTCCTGG + Intergenic
979219048 4:118200105-118200127 TCAAGGGAAGAACATAGGCCTGG - Intronic
979504480 4:121479981-121480003 TGAAGGGAAAAATCCAGTCTTGG - Intergenic
979572964 4:122252070-122252092 TGAAGGAAAGGACCCAGTCCTGG + Intronic
980172425 4:129305965-129305987 TAAAGGGAAGGACCCAGTCCTGG - Intergenic
980531419 4:134060618-134060640 TGAAGGGAAGGACTCAGTCCTGG + Intergenic
980657761 4:135811903-135811925 GGAAGGGAAGAACCAAATCCTGG + Intergenic
980682877 4:136187109-136187131 GGAAGGGAAAAACTCAGTCCTGG + Intergenic
980723558 4:136728027-136728049 TGAAGGAAAGAACCCAGACCTGG - Intergenic
980960589 4:139470760-139470782 TGAAGGAAAAAATCCAGTCCTGG - Intronic
981298150 4:143156496-143156518 TGAAAGGAAGAATCCAGTTCTGG - Intergenic
981350811 4:143727459-143727481 GAAAGGGAAGAACAGAGTCCAGG + Intergenic
981394669 4:144233808-144233830 TGAAGGGAAGGACCCTGTCCTGG + Intergenic
981558639 4:146023277-146023299 TGAAGGGAAGGACCGAGTCCTGG - Intergenic
981836828 4:149064564-149064586 TGAAGGGGAGGACCCAGTCCTGG + Intergenic
981975537 4:150723480-150723502 TGAAGGTAAGGATCCAGTCCTGG + Intronic
981996135 4:150977418-150977440 TGAAGGGAATGACCCAATCCTGG + Intronic
982622752 4:157727656-157727678 TGAAGGTAAGGATCCAGTCCTGG + Intergenic
982719724 4:158847514-158847536 TGAAGGGAAGGACCCAGTACTGG + Intronic
982828332 4:160027722-160027744 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
982899550 4:160981021-160981043 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
982911538 4:161148638-161148660 TGAAGGGAAGAACCCAGTCCTGG + Intergenic
983017206 4:162628269-162628291 TAAAGGGAAGGACCCAGTCCTGG + Intergenic
983165993 4:164477791-164477813 TGAAGGGAAGGATCCAGTCCTGG - Intergenic
983338095 4:166421441-166421463 TGAAGGGAAGAACCCAGTCCAGG - Intergenic
983388904 4:167103119-167103141 GAAAGGGAAGGACCTAGTCCTGG + Intronic
983421759 4:167527174-167527196 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
983619700 4:169747871-169747893 TGAAGCTAAGAACCAGGTGCTGG - Intronic
983657936 4:170101615-170101637 TGAAGGAAAAAACAAAGTCCTGG + Intergenic
983658081 4:170102616-170102638 TAAAGGGAAGGACCCAGTCCTGG - Intergenic
983931756 4:173460587-173460609 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
983931863 4:173461154-173461176 TGAAGGGAAGAACACAGGCCTGG + Intergenic
985341490 4:188959420-188959442 TGAAAGGAAGAACCAGCTCTGGG + Intergenic
985444258 4:190012371-190012393 TGAAGAAAAGAACCATGTGCTGG + Intergenic
985578634 5:685277-685299 TGAAGGCCAGAGCCAAGCCCAGG + Intronic
985794169 5:1949641-1949663 TTCAGGGAAGCCCCAAGTCCTGG + Intergenic
986046717 5:4044976-4044998 TGAAGGGAAGAACTCAAGCCTGG + Intergenic
986256589 5:6105986-6106008 TGGATGGAAAAACCAAGCCCTGG - Intergenic
986544469 5:8880337-8880359 TGAAGGGAAGGACCTTGTCCTGG - Intergenic
986631193 5:9775664-9775686 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
986824625 5:11507255-11507277 CGAAATGAAGAATCAAGTCCAGG + Intronic
986899389 5:12413142-12413164 TGAAGGAAAGAACCCAGTCCTGG - Intergenic
987170258 5:15248745-15248767 AGAAGGGAAAAACAAATTCCAGG - Intergenic
987496599 5:18653038-18653060 TGGAGGGAAGGACCCAGTCCTGG - Intergenic
987564261 5:19564486-19564508 TGAAGGGAAGAACCCAGTCCTGG + Intronic
987645853 5:20671806-20671828 TGAAAGGAAGGGCCCAGTCCTGG + Intergenic
987823082 5:22991281-22991303 TGAAGGGAAAGACCCAATCCTGG + Intergenic
987903854 5:24050606-24050628 TAAAGAGAAAGACCAAGTCCTGG + Intronic
988001715 5:25358307-25358329 TGAAAGGAAGGATCTAGTCCTGG + Intergenic
988236935 5:28557549-28557571 TATAGGGAAGAGCCCAGTCCTGG - Intergenic
988265341 5:28942087-28942109 TGAAAGGAAGAACCCAGTTCTGG - Intergenic
988299385 5:29403412-29403434 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
988299479 5:29403959-29403981 TGAAAGGAAGAACCTAGACCTGG + Intergenic
988319551 5:29675539-29675561 TGCATGGAGGGACCAAGTCCTGG + Intergenic
988376200 5:30439176-30439198 TGAATGGAAGGATCCAGTCCTGG + Intergenic
988384171 5:30539729-30539751 TGAAAAGAAGGACCCAGTCCTGG + Intergenic
988608543 5:32703580-32703602 TGAAGGGAAGGACCCAGTCCTGG - Intronic
988665921 5:33327264-33327286 TGAAGGGAAGAACAAAGAAAGGG - Intergenic
988939425 5:36127836-36127858 TGAAGGGAAGAACAAAAGCTCGG + Intronic
988956353 5:36324085-36324107 TTAAGGGAAGGACCCAGTCCTGG - Intergenic
989657742 5:43762298-43762320 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
989672578 5:43936083-43936105 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
989681218 5:44031967-44031989 TGAAGGAAAAGACCCAGTCCTGG + Intergenic
989723012 5:44552386-44552408 TGAAGGGAAGGACACAGGCCTGG - Intergenic
989751158 5:44895507-44895529 TGAAGAGAAAGACAAAGTCCTGG - Intergenic
990284042 5:54281814-54281836 TGAATGTAAGAAACAAGTCACGG - Intronic
990347275 5:54883374-54883396 GGGAGGGAAGAACCAAGTACAGG + Intergenic
990592858 5:57283452-57283474 TGAAGAGGAGGACCTAGTCCTGG + Intergenic
990827909 5:59922623-59922645 TGAAGGGAAGGAAGCAGTCCTGG + Intronic
990899914 5:60739086-60739108 TGAAGGAAAAAACCCAGTCCTGG + Intergenic
991018487 5:61956586-61956608 TGAAGGGAAGAACACAAGCCTGG - Intergenic
991018697 5:61958321-61958343 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
991107488 5:62861161-62861183 TGAAAGGAAGGACCCAATCCTGG - Intergenic
991180625 5:63746991-63747013 TGAAGGAAAGAACCCAGTCCTGG - Intergenic
991209164 5:64084638-64084660 TGAAGGGAAGTACCCGGTCCTGG - Intergenic
991395318 5:66198741-66198763 TGAAGGGAAAGACACAGTCCTGG - Intergenic
992345277 5:75869590-75869612 TGAAGAGAAGGACAAAGGCCTGG + Intergenic
992454271 5:76901936-76901958 TGAAGGAAAGAACCCGGTCCTGG - Intronic
992657218 5:78922468-78922490 TGAAGGGAAGAACCCAGTCCTGG + Intronic
992859869 5:80899085-80899107 TGAAGGCCAGAACCAAGGTCTGG + Intergenic
992934506 5:81687772-81687794 TGAAGGGAAGAACCCAGTCTTGG + Intronic
993197280 5:84764892-84764914 TGAAGGAAAGGACCTAGTTCTGG - Intergenic
993279347 5:85905329-85905351 TGAAGGGAAGAACCAAGTCCTGG + Intergenic
993650125 5:90509939-90509961 TGAATGGAAGAGCCAAGTTTGGG + Intronic
993858144 5:93100671-93100693 TGAAGAGCAGACTCAAGTCCAGG + Intergenic
993981232 5:94545631-94545653 TGATGAGAAGGACCCAGTCCTGG + Intronic
994028547 5:95114058-95114080 TGAAGGGAAGGAGCCAGTCCTGG + Intronic
994041829 5:95267696-95267718 TGAAGGGAAGAACCATCTTCAGG - Intronic
994217887 5:97159355-97159377 TAAAAGGAAGGACCCAGTCCAGG - Intronic
994226143 5:97253751-97253773 TGAAGGGAAGGATCCAGTCCTGG + Intergenic
994233860 5:97339314-97339336 TGAAGGGAAGGGCCTAATCCTGG + Intergenic
994264607 5:97700079-97700101 TGAAAGGAAGGACCCAGTCCTGG + Intergenic
994310104 5:98259540-98259562 TGAGGGGAGGGACCTAGTCCTGG - Intergenic
994477549 5:100290282-100290304 TGAAGGGAAAAACACAGGCCTGG - Intergenic
994530043 5:100957280-100957302 TGAAGGGAAGGACAAAGATCTGG + Intergenic
994659982 5:102641777-102641799 TGAAGGGAAGGATCCAGTCCTGG + Intergenic
995019615 5:107352272-107352294 TGAAGGAAAGGACCCATTCCTGG - Intergenic
995049722 5:107688435-107688457 TGAAGGGAAGAACACAAGCCTGG + Intergenic
995096348 5:108239978-108240000 TGAAGGGAAGGACCTTGGCCTGG + Intronic
995146937 5:108797097-108797119 TGAAAGGGAGGACCCAGTCCCGG - Intronic
995262536 5:110122455-110122477 TGAAAGGAAGGACCTAGTCCTGG - Intergenic
995265273 5:110152406-110152428 TGAAGGGAAGGACCAAGTCTTGG + Intergenic
995268661 5:110195167-110195189 TGAAAGGAAGGAACCAGTCCTGG - Intergenic
995290291 5:110443810-110443832 TGAAAGGAAGGACCCAGTCCTGG - Intronic
995310773 5:110707932-110707954 TGAAGGGAAGAACTCAGTCCTGG + Intronic
995371824 5:111427269-111427291 TGAAAGAAAGGACCCAGTCCTGG + Intronic
995573188 5:113503069-113503091 TGAAGGGAAGTTACCAGTCCTGG - Intergenic
995603984 5:113831015-113831037 TGAAGAGAAAAAGCAAGTACTGG + Intergenic
995697825 5:114899809-114899831 TGAAGGGAAGGAATTAGTCCTGG - Intergenic
995777896 5:115745480-115745502 TGAAGGGAAGGACACAGGCCTGG - Intergenic
995787625 5:115847115-115847137 TGAAGGGAAAGACACAGTCCAGG - Intronic
996161704 5:120174274-120174296 TGAAGGGAAGGACATAGCCCTGG + Intergenic
996594454 5:125185120-125185142 TGAAGGAAAGGACTCAGTCCTGG + Intergenic
996594570 5:125185801-125185823 TGAAGGGAAGGACACAGGCCTGG + Intergenic
996666540 5:126066518-126066540 TCAAGGGAAGAACTCAGTCCTGG + Intergenic
996945001 5:129055996-129056018 TGAAGGGAAGGGCCTAGTCCTGG + Intergenic
996961529 5:129255799-129255821 TGAAGGAAAGGACCCAGTCTTGG - Intergenic
996982697 5:129519200-129519222 TGAAGAAAGGAACCCAGTCCTGG - Intronic
997073307 5:130642628-130642650 TGAAGGGAAGAACCAAGTCTTGG - Intergenic
997101081 5:130970077-130970099 AGAAGCCAAGAAACAAGTCCTGG - Intergenic
997832626 5:137164363-137164385 TGAGGGGAAGGACCCAGTCCTGG + Intronic
998058125 5:139096726-139096748 TAAAGGGAAGGACCCAGTCCTGG + Intronic
998633983 5:143932059-143932081 TGAAGAGAAGGATCCAGTCCTGG + Intergenic
998695295 5:144631229-144631251 TGAAGGAAAGAACACAGGCCTGG + Intergenic
998716488 5:144890005-144890027 TGAGGGGAAGGACAAAGGCCTGG + Intergenic
999406610 5:151312479-151312501 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
999559526 5:152785680-152785702 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
1000159872 5:158586977-158586999 TGAAGGAAAGGACTCAGTCCTGG - Intergenic
1000270185 5:159676895-159676917 TGAAAGAAAGAACCCAGTCCTGG + Intergenic
1000454907 5:161437417-161437439 TGAAGGAAAAGACCCAGTCCTGG + Intronic
1000498824 5:162021664-162021686 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1001177638 5:169486784-169486806 TGAAGGAAAGGACCCAGCCCTGG + Intergenic
1001845359 5:174917037-174917059 TAAAGGAAAGAACCCAGTCCTGG + Intergenic
1004829171 6:19458755-19458777 TGATGGAAAGAACAAATTCCAGG + Intergenic
1005157092 6:22819456-22819478 TGAAGGGAAGGGCCCAGTCCTGG - Intergenic
1006454989 6:34126559-34126581 TGAGGGGAAGAAACATATCCAGG + Intronic
1006463005 6:34174752-34174774 TGAAGGGAAGGGCCCAGGCCTGG - Intergenic
1006554279 6:34852352-34852374 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1007001671 6:38319515-38319537 TGACGGGAAGGACCCAGTCCTGG - Intronic
1007021835 6:38528694-38528716 TGAAGGGAAGGACCCAGTCCTGG + Intronic
1008017830 6:46541428-46541450 TGAAGGGAGGGACCCAGTCCTGG + Intergenic
1008227321 6:48936549-48936571 TGAGGGGAAGGAGCCAGTCCTGG - Intergenic
1008238864 6:49084273-49084295 TGAAAGGAAAAACCTAGTCCTGG + Intergenic
1008240381 6:49102654-49102676 TAAAGGGAGGAACCTAGCCCTGG + Intergenic
1008312243 6:49990296-49990318 TGAAGGGAAGGACATAGGCCTGG + Intergenic
1008642053 6:53474262-53474284 TGAAGGGAAGCAGCTAGTCCTGG - Intergenic
1008752858 6:54757894-54757916 TGAAGGAAACAACCCAATCCTGG - Intergenic
1008848540 6:55996695-55996717 TAAAGGGAAGAACCTAGTCTTGG - Intergenic
1009245526 6:61232171-61232193 TGAAGGGAAAAACACAGGCCTGG + Intergenic
1009308978 6:62125762-62125784 TGAGAGGAAGGACCCAGTCCTGG + Intronic
1009375301 6:62961133-62961155 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
1009390714 6:63140237-63140259 TAAAGGGAAAGACCCAGTCCTGG + Intergenic
1009748285 6:67848286-67848308 TGAAGGGACGGACCAAGTCCTGG + Intergenic
1009978646 6:70700859-70700881 TGAAGGGAAGGACACAGTTCTGG - Intronic
1010062189 6:71635893-71635915 TAAAGGGAAGGACTGAGTCCTGG - Intergenic
1010139948 6:72602505-72602527 TAAAGGGAAGAAACAAGTCATGG - Intergenic
1010280670 6:74019209-74019231 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
1010285636 6:74074439-74074461 TGAAGGGAGAGAGCAAGTCCTGG - Intergenic
1010299422 6:74243145-74243167 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1010324619 6:74550381-74550403 TGAAGAAAAGGACCTAGTCCTGG - Intergenic
1010596505 6:77769768-77769790 TGAAGGGAAGGGCCCAGTCCTGG + Intronic
1010644733 6:78373346-78373368 TGAAGAGTAGGACCCAGTCCTGG + Intergenic
1010676635 6:78753479-78753501 TGAAGGGAAGAATTCAGTCCTGG + Intergenic
1011033181 6:82944380-82944402 TAAAGGGAAGGACCCAGTCCAGG + Intronic
1011291192 6:85779134-85779156 TGAAGGGAAGAACCAAGTCCTGG - Intergenic
1011322851 6:86116155-86116177 TAAAAGGAAGAACCCAGTCCTGG - Intergenic
1011340972 6:86313786-86313808 TAAAGGGAAGGACCTAGTCCTGG + Intergenic
1011343217 6:86340378-86340400 TGAAAGAAAGGACCCAGTCCTGG + Intergenic
1011598359 6:89037675-89037697 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
1011791880 6:90907459-90907481 TGAAGAGAAGGACCCAGTCTTGG - Intergenic
1012028596 6:94029543-94029565 TGAAGGGAAGGACCCAGTTTTGG + Intergenic
1012049914 6:94328472-94328494 TGAAGGAAAGGACCCAGTGCTGG + Intergenic
1012050003 6:94329126-94329148 TGAAGGGAAGGACACAGCCCTGG + Intergenic
1012057051 6:94426612-94426634 TGAAGGAAAGGACCCAGTTCTGG - Intergenic
1012073687 6:94657074-94657096 TGAAGGGAAGAACAAAAACCTGG - Intergenic
1012288433 6:97421968-97421990 TAAAGGAAAGGACCACGTCCTGG - Intergenic
1012486276 6:99725443-99725465 TGAAGGGAAGGACCCAGTGCTGG - Intergenic
1012620648 6:101339937-101339959 TGAAGGGAAGGACTCAATCCTGG - Intergenic
1012678904 6:102153914-102153936 TGAAGCAAAGAACCCAGTCCTGG + Intergenic
1012717816 6:102699143-102699165 TGAAGGGAAGGATTCAGTCCTGG - Intergenic
1012827312 6:104162748-104162770 TGAAAGGAAGGACCCAGTTCTGG + Intergenic
1012827628 6:104165353-104165375 TGAAGGAAAGGACCCAGTGCTGG + Intergenic
1014234595 6:118940174-118940196 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1014855575 6:126396779-126396801 TGAAGAGAAGAACCCAGTCCTGG - Intergenic
1014865280 6:126521488-126521510 GGAAGAAAAGAACCCAGTCCTGG - Intergenic
1014928470 6:127303977-127303999 TGCAGGGAAGAACACAGGCCTGG + Intronic
1015030286 6:128586556-128586578 TAAAGGAAAGGACCCAGTCCTGG + Intergenic
1015392907 6:132702789-132702811 TAAATGGAAGGACCCAGTCCTGG + Intronic
1015959410 6:138631633-138631655 TGAAAGGAAGGACCTACTCCTGG + Intronic
1016045963 6:139480844-139480866 TGAAGGGAAGATGCAAGCCTTGG + Intergenic
1016061614 6:139636645-139636667 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1016136954 6:140555464-140555486 TGAAGGAAAGGACTCAGTCCTGG - Intergenic
1016151120 6:140744484-140744506 TGAAGGAAAGAACCTAGTCCTGG + Intergenic
1016228399 6:141771549-141771571 TGAAGGGAAGAACACAATACTGG - Intergenic
1016229777 6:141788843-141788865 TGAAGGGAAGGACCCAGTACTGG + Intergenic
1016392111 6:143585095-143585117 TGACGGGCAGGACCAAGGCCTGG + Intronic
1016457387 6:144245205-144245227 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1016541517 6:145170881-145170903 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
1016618605 6:146081048-146081070 TGAATAGATGACCCAAGTCCAGG + Intronic
1016623838 6:146143120-146143142 TGAAGGGAAGGACCCAGTCCTGG - Intronic
1016643732 6:146380167-146380189 TGAAGGCAAGAACACAGACCTGG - Intronic
1017243471 6:152196507-152196529 TGAAGGGAAGGACCTAGTCCTGG - Intronic
1017318716 6:153062911-153062933 TGAAGGGAAGCACCCAGTCCTGG + Intronic
1017387352 6:153901454-153901476 TAAAGGGAAGAAACCAATCCTGG + Intergenic
1017398097 6:154027538-154027560 TGAAGGGAAGGACACAGGCCTGG - Intronic
1017398204 6:154028206-154028228 TCAAGGGAAGAACCCAGTCCTGG - Intronic
1019044369 6:169131866-169131888 TGAGGAGAAGGACCCAGTCCTGG + Intergenic
1019066390 6:169302770-169302792 TGAAGGGAAGGACCCGGTCCTGG + Intergenic
1019598478 7:1869376-1869398 CAAGGGCAAGAACCAAGTCCAGG + Intronic
1020038826 7:4985830-4985852 GGAAGGGAAGAACCAAGCCAAGG + Intronic
1020156477 7:5728649-5728671 GGAAGGGAAGAACCAAGCCAAGG - Intronic
1020485413 7:8714667-8714689 TGAAGGGAAAGACCCAGTCCTGG - Intronic
1020514970 7:9106779-9106801 TGAAGGGTGGGACCCAGTCCTGG + Intergenic
1020572977 7:9890015-9890037 TGAAGGGAAAGACCCAGTCGTGG + Intergenic
1020574853 7:9913408-9913430 TAAAGGGAAGAACCCAGTCTTGG - Intergenic
1020607405 7:10356438-10356460 TGAAGAGAAAGACCAAGTCCTGG - Intergenic
1020985951 7:15134475-15134497 GGAAGGGAACAACCAACACCAGG - Intergenic
1021034773 7:15784712-15784734 TGAAGGGAAGAACTCAGTCCTGG + Intergenic
1021046114 7:15925007-15925029 TAAAGGGAAGGATCCAGTCCTGG + Intergenic
1021123709 7:16826181-16826203 TGAAAGGAATGACCCAGTCCTGG + Intronic
1021130914 7:16912714-16912736 TGGAGGGAAGGACACAGTCCTGG - Intergenic
1021203603 7:17753429-17753451 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
1021214633 7:17901043-17901065 TGAAGGGAAGGACCTAGTCCGGG - Intronic
1021382427 7:19984023-19984045 TGAAGGAAAGGACCCAGTGCTGG - Intergenic
1021640944 7:22735615-22735637 TGAATGAAAGGACCCAGTCCTGG + Intergenic
1021884888 7:25128866-25128888 TAAAGGGAAGAGCCCAGGCCTGG - Intergenic
1022061182 7:26797140-26797162 TGAAGGAAAGGACACAGTCCTGG + Intronic
1022080184 7:27012570-27012592 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
1022223616 7:28340367-28340389 TGAATGGAAGCACCCAGTCCTGG - Intronic
1022541995 7:31146251-31146273 TGAAGGGAAGGGCTCAGTCCTGG - Intergenic
1022741157 7:33122965-33122987 TGAAGGGAAGGACCTAGTTCTGG - Intergenic
1022898410 7:34776789-34776811 TGAAGGGAAGGACATAGTCCTGG - Intronic
1023058187 7:36306348-36306370 TGCACTGAAGAACCAAGCCCTGG - Intergenic
1023208932 7:37782274-37782296 TGAAAGGAAGGACTCAGTCCTGG - Intronic
1023646245 7:42318834-42318856 TGAAGGGGAGGACCCAGTCCTGG + Intergenic
1024170269 7:46777907-46777929 TGAAGAGAAGAACCCAGTCCTGG + Intergenic
1024415012 7:49096357-49096379 TGAAGGGAAGGAATCAGTCCTGG + Intergenic
1024498402 7:50072436-50072458 TGAAGGGAAGGACAAAGGCCTGG + Intronic
1025137909 7:56436136-56436158 TGAATGGAAAGACCCAGTCCTGG + Intergenic
1025227593 7:57178353-57178375 TGAAGGGAACCAGCACGTCCAGG + Intergenic
1025718172 7:63983170-63983192 TGCAGGGAAGGACTTAGTCCTGG + Intergenic
1027604861 7:80287888-80287910 TGAAGTGAAGGACCCAGTTCTGG + Intergenic
1027674678 7:81143096-81143118 TGAAGGGAAGGAGCTAGTCCTGG + Intergenic
1028181566 7:87730645-87730667 TGAAGGGAAGGACACAGACCTGG + Intronic
1028207466 7:88033610-88033632 TGTAGGGAAGAACAAAGGCCTGG - Intronic
1028207583 7:88034267-88034289 TAAAGGGAAGGACCAACTTCTGG - Intronic
1028266599 7:88733729-88733751 TGAAGGGAAGGATCCAGTCCTGG - Intergenic
1028284635 7:88981228-88981250 TGAAGGGAAGTACTCACTCCTGG - Intronic
1028929571 7:96397850-96397872 TGAAGGAAATGACCCAGTCCTGG - Intergenic
1028950501 7:96630192-96630214 TGAAAGGAAGAACACAGGCCTGG - Intronic
1029665723 7:101993858-101993880 TGAAGGGGAGAAGGGAGTCCAGG - Intronic
1029732523 7:102447555-102447577 GGCAGGGAAGCACCAAGCCCTGG - Exonic
1029797345 7:102909614-102909636 TGAAGGAAGGGACCCAGTCCTGG - Intronic
1029861660 7:103579083-103579105 TGAAGGCAGGAACCATGTCTGGG - Intronic
1030222423 7:107110687-107110709 TGAAGGGAAGGACCCAGTACTGG + Intronic
1030370510 7:108694362-108694384 TGAAGGAAAGGACCCAGTTCTGG - Intergenic
1030598962 7:111571157-111571179 TGAAGGGAAGGACACAGGCCTGG + Intergenic
1030629418 7:111879243-111879265 TGAAGGGAAGGACTCAATCCTGG + Intronic
1030990310 7:116291429-116291451 TGAAGGGAAGGACCTAGTTCTGG + Intronic
1031260051 7:119507045-119507067 TGAAGGGAAAGATCCAGTCCTGG + Intergenic
1031260154 7:119507692-119507714 TGAAGGGAAGGACACAGACCTGG + Intergenic
1031280813 7:119797383-119797405 TGAAGGAAAGGACTCAGTCCTGG - Intergenic
1031412534 7:121457038-121457060 TTAAGGAAAGAACCTAGTACTGG - Intergenic
1031442534 7:121811918-121811940 TGAAGGAAAGGACCCAGTTCTGG + Intergenic
1031565913 7:123296727-123296749 TGAAGGCAAGGACTCAGTCCTGG + Intergenic
1031565956 7:123297035-123297057 TGAAGGGAAAGACCTAATCCTGG + Intergenic
1031862276 7:126994258-126994280 TGAAGGGAATGAACAAGTACTGG + Intronic
1032705000 7:134414038-134414060 TAAAGGGAGGAATCAAGCCCTGG + Intergenic
1032939111 7:136768149-136768171 TGAAGGGAAAGACCAAGTCTGGG + Intergenic
1032972011 7:137175160-137175182 TGAAGGGAAGGACACAGTCTTGG + Intergenic
1033691292 7:143740197-143740219 TGAAAGAAAGGACCCAGTCCTGG + Intergenic
1034018974 7:147619762-147619784 TGAAGGGAAGGACATAGGCCTGG + Intronic
1034581819 7:152050338-152050360 TGAACGGAAGGACCTAGTACTGG - Intronic
1035053980 7:156021629-156021651 TGAAGGGAATGGCCAAGTTCAGG - Intergenic
1035060619 7:156066707-156066729 TGAAGGAACGAACCAAGCTCTGG + Intergenic
1035084550 7:156247137-156247159 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1035754088 8:2018117-2018139 TGAAGAGAAGAACCCAGTCCTGG - Intergenic
1035851275 8:2921606-2921628 TGAAGGGAAGAAAATAGTTCAGG + Intergenic
1037254810 8:16941694-16941716 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
1037277249 8:17193600-17193622 TGAAGGGAAGGACCCAAGCCTGG - Intronic
1037354173 8:17999387-17999409 TAAAGGGAAAGACCCAGTCCTGG - Intronic
1039647377 8:39302929-39302951 TGAAGGGAAGGACAAAGATCTGG - Intergenic
1040095784 8:43440896-43440918 TGAAGGGAAGAACACTGGCCTGG + Intergenic
1040511530 8:48100358-48100380 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1040743156 8:50604971-50604993 TGAAGGGAGGGACCCAGTCTGGG - Intronic
1040811170 8:51455397-51455419 TGAAGATAAAAACAAAGTCCTGG + Intronic
1040841617 8:51791124-51791146 TGAAGGGAAAATTCAAGTGCAGG + Intronic
1041415985 8:57609320-57609342 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
1041416094 8:57609991-57610013 TGAAGGGAAGAACACAAGCCTGG + Intergenic
1041582898 8:59483327-59483349 TGAAGGGAAAAACCTAGTCTTGG - Intergenic
1041606895 8:59792624-59792646 TGAAGAGAAGGAACCAGTCCTGG + Intergenic
1041616008 8:59907434-59907456 TGAAGGGAAGAGTCCAGTCCTGG + Intergenic
1041869285 8:62615226-62615248 TGAAGGAAAGGACCCAGTCCTGG - Intronic
1041883367 8:62778937-62778959 TGAAGGGAAGGATCAAGTCCTGG - Intronic
1042162601 8:65912401-65912423 TGAAGGGAAGGAACCAGTCCTGG + Intergenic
1042726792 8:71887978-71888000 TGAAGGGAAGGACACAGGCCTGG - Intronic
1042726891 8:71888610-71888632 TGAAGGAAAGAACACAGTCTCGG - Intronic
1043080063 8:75755402-75755424 TGAAGGGAAGTACTCAATCCTGG + Intergenic
1043323286 8:79017714-79017736 TGAAGGGAAGGACACAGACCTGG - Intergenic
1043340197 8:79229159-79229181 TGAAGGGAAGGACACAGACCTGG - Intergenic
1043366831 8:79542791-79542813 TGAAGGAAAGGACACAGTCCAGG + Intergenic
1043567298 8:81562197-81562219 TGAAGGGAAGGACCCAGTTCTGG + Intergenic
1043760610 8:84063321-84063343 TGAAAGGAAGGACCGAATCCTGG - Intergenic
1045041340 8:98227480-98227502 TGAAGGGAAGGACCTAGTCCTGG - Intronic
1045589923 8:103582204-103582226 TGAAGGAAAGGACTCAGTCCTGG + Intronic
1045733457 8:105267716-105267738 TGAAGGGAAGGACCTAGTCCTGG - Intronic
1045777370 8:105821721-105821743 TGAAGGAAAGAACACAGGCCTGG - Intergenic
1045994889 8:108351487-108351509 TGAAAGGATGGACCCAGTCCTGG + Intronic
1046149970 8:110211251-110211273 TGAAGGGAAGGACTCAGTCCTGG + Intergenic
1046384125 8:113486738-113486760 TGAAGTGAAGAACCCAGTCCTGG - Intergenic
1046448487 8:114357111-114357133 TGAAAGAAAGAACATAGTCCTGG + Intergenic
1046463326 8:114570652-114570674 TGAAGGGAAGGATGCAGTCCTGG - Intergenic
1046670742 8:117053496-117053518 TGGATGGAAGAACCATTTCCTGG + Intronic
1047608540 8:126498176-126498198 TGAGGGGAAGAAAGAAGTCAGGG + Intergenic
1047841160 8:128754721-128754743 TGAAGGGAGAGACCCAGTCCTGG + Intergenic
1047901076 8:129422972-129422994 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1047910100 8:129518472-129518494 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1047933607 8:129753417-129753439 TGAAGGGAAGAACACAGTCCTGG + Intronic
1047937998 8:129800596-129800618 TGAAAGGAAGGACCCAGTCCTGG - Intergenic
1048029934 8:130621503-130621525 TGAAGGGAAGGACCCAGTTCTGG - Intergenic
1048635691 8:136292760-136292782 TGAAGGAAACCACCACGTCCTGG - Intergenic
1048646640 8:136428202-136428224 TGAAGGGAAAAACTAAGTCCTGG + Intergenic
1048820049 8:138372215-138372237 TGAAGGGCAGTACCAAGGGCAGG - Intronic
1049115768 8:140686207-140686229 TGAAGGGAACAACAGACTCCGGG + Intronic
1050145287 9:2560598-2560620 TGAAGGGAAGAACAAAAGCCTGG + Intergenic
1050238850 9:3613054-3613076 TGAAGGGAAAGACCCATTCCTGG - Intergenic
1050248159 9:3713618-3713640 TGAAGGGAAGGACCAAGTATTGG + Intergenic
1050508191 9:6368994-6369016 TGAAGGGAAGGGCCCAGTTCTGG + Intergenic
1050618650 9:7429613-7429635 TGAGGGAAAGAACCCAGTCCTGG - Intergenic
1050644322 9:7702725-7702747 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
1050681360 9:8115532-8115554 TTGAGGGAAGAGCCAAGTCTGGG - Intergenic
1050807176 9:9695184-9695206 TGGAGGGAAGGACCCAGTCCTGG - Intronic
1050865225 9:10489184-10489206 TGAAGGCAATGACCCAGTCCTGG - Intronic
1051047171 9:12888819-12888841 TGAAGAGAAGGACTCAGTCCCGG + Intergenic
1051306693 9:15717754-15717776 TGAAGTGAAGGACCCAATCCTGG + Intronic
1051704300 9:19860364-19860386 TGAAGGCAAGAACCCAGTCCTGG + Intergenic
1051724664 9:20076679-20076701 TAAAGGGAAGAACAAGTTCCTGG + Intergenic
1051921844 9:22275503-22275525 TGAAGGGAAGGACACAGGCCTGG + Intergenic
1052063278 9:23986901-23986923 TGAAGGAAAGGACCCAGTCATGG + Intergenic
1052204945 9:25827919-25827941 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
1052214660 9:25951435-25951457 TGAAAGAAAGGACCCAGTCCTGG - Intergenic
1052258712 9:26490653-26490675 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1052258810 9:26491210-26491232 TGAAGGAAAGAACCTAGTCCTGG - Intergenic
1052667022 9:31508111-31508133 TAAAGAGAAGGACAAAGTCCTGG - Intergenic
1053040020 9:34862565-34862587 TGAAGGGAAGGACCTAGTCCTGG + Intergenic
1053110183 9:35453184-35453206 TCAAAGGAAGGACCCAGTCCTGG + Intergenic
1053204405 9:36173977-36173999 TGAAAGGAAGAATCCAATCCAGG + Intergenic
1053283702 9:36837513-36837535 TGAATGGAAAACACAAGTCCGGG - Exonic
1053692576 9:40593573-40593595 AGCAGGGAAGAACCAGGGCCAGG - Intergenic
1054272241 9:63043960-63043982 TGCAGGGAAGAACCAGGGCCAGG + Intergenic
1054303818 9:63394491-63394513 AGCAGGGAAGAACCAGGGCCAGG - Intergenic
1054402596 9:64721001-64721023 AGCAGGGAAGAACCAGGGCCAGG - Intergenic
1054436207 9:65205332-65205354 AGCAGGGAAGAACCAGGGCCAGG - Intergenic
1054494185 9:65816355-65816377 AGCAGGGAAGAACCAGGGCCAGG + Intergenic
1054982564 9:71223322-71223344 TAAAGGGAAGGACCCATTCCTGG + Intronic
1055015602 9:71614603-71614625 TCAATGGAAGAGCAAAGTCCAGG + Intergenic
1055081940 9:72276022-72276044 TGGAATGAAGAACCATGTCCAGG - Intergenic
1055243784 9:74217128-74217150 TGAAGGGAAGGACCCAGTACTGG - Intergenic
1055302023 9:74891954-74891976 TGAAGGGAGGGACCCAATCCTGG + Intergenic
1055387249 9:75775724-75775746 TGAAGGGAAAAACCAAATCCTGG + Intergenic
1055826988 9:80339073-80339095 TGAAGCGAAGGAGCCAGTCCTGG + Intergenic
1056007243 9:82285526-82285548 TGAAGGACAGGACCCAGTCCTGG + Intergenic
1056007350 9:82286198-82286220 TGAAAGGAAGGACACAGTCCTGG + Intergenic
1056172517 9:84000375-84000397 CAAAGGGATGATCCAAGTCCAGG - Intronic
1056230599 9:84539158-84539180 GGAAGGGAAGGACCTAGTCCTGG - Intergenic
1056338796 9:85603432-85603454 TAAAGGGAACAACCCAGTCCTGG + Intronic
1056424733 9:86465194-86465216 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
1056509109 9:87285785-87285807 TGTAGGAAAGAACCAGGTACTGG + Intergenic
1058022746 9:100106701-100106723 AGAATGGAAGAACCAAGGCCTGG - Intronic
1058249097 9:102669116-102669138 TGAAGAGAAGGACCCAGTACTGG - Intergenic
1058820866 9:108728252-108728274 TGAATGGAAGGACCTAGTCCTGG + Intergenic
1059041705 9:110822233-110822255 TGAAGGGAAGGACCCATTCTTGG + Intergenic
1059515361 9:114889426-114889448 TGAAGGAAAGGACACAGTCCTGG + Intergenic
1059886632 9:118751567-118751589 TGAAAGGAAGGACCTAGTTCTGG + Intergenic
1060064452 9:120491098-120491120 AGAAGGGAAGAAACATATCCTGG - Intronic
1060084153 9:120681255-120681277 TCAAGGGAAGGACCCAGTCCTGG - Intronic
1060243479 9:121925173-121925195 TGAAGGAAAGACCAAAGTGCTGG + Intronic
1060328677 9:122643879-122643901 TGATGGAAAGAACCTAGTCCTGG + Intergenic
1061026866 9:128055402-128055424 GGAAGGGAAGAAGCGACTCCAGG + Intergenic
1061638235 9:131929138-131929160 TGAAGGGATGGACCTAGTCCTGG + Intronic
1061915611 9:133751650-133751672 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1185843555 X:3416192-3416214 AGAATGAAAGAGCCAAGTCCAGG - Intergenic
1186270569 X:7882730-7882752 AGAAAGAAAGAACCAAGTCCAGG + Intergenic
1186601943 X:11048021-11048043 TGAAGGGAAGGACAAAGTGCTGG - Intergenic
1186602170 X:11049768-11049790 TGAAGAGAAGGACCCAGTCCAGG - Intergenic
1186720017 X:12294062-12294084 TGAAGGGAAGAAGAAAGTGAGGG - Intronic
1186911713 X:14174421-14174443 TGAAGGGAAGGATCCAGTCCTGG - Intergenic
1187090965 X:16096118-16096140 TGAAAGGAAGTACTCAGTCCTGG - Intergenic
1187132736 X:16518197-16518219 TGAAGGGAAAGACCCAGTGCTGG + Intergenic
1187594510 X:20756384-20756406 TGAAAGGAAGGACCCAATCCAGG - Intergenic
1187610614 X:20939227-20939249 TGAAGGAAAAGACCAAGTCCTGG - Intergenic
1187618075 X:21020277-21020299 TGAAGGGAAGAACTCAGTCCTGG + Intergenic
1187655154 X:21463675-21463697 TAAGGGGAAGGACCCAGTCCAGG - Intronic
1188027594 X:25226656-25226678 TGAAGAGAAGGACCTGGTCCTGG + Intergenic
1188040471 X:25365960-25365982 TGAAGGGAATGACAAAGGCCTGG - Intergenic
1188046281 X:25428853-25428875 TGAAGGGAAACACATAGTCCTGG - Intergenic
1188071840 X:25727115-25727137 TGAAGGAAAGGACTGAGTCCTGG - Intergenic
1188108284 X:26168037-26168059 TGAAGGAAAGGACTCAGTCCTGG - Intergenic
1188140830 X:26548417-26548439 TGAAGGGAATGATGAAGTCCTGG - Intergenic
1188210608 X:27419317-27419339 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
1188220025 X:27530191-27530213 TCAGGGGAAGAACCAATTGCTGG + Intergenic
1188421154 X:29992052-29992074 TGAAGGGAGGGACTGAGTCCTGG - Intergenic
1188651337 X:32634563-32634585 TGAAGAGAAGGACCCCGTCCTGG - Intronic
1188668349 X:32852310-32852332 TGAAGAGAAGAATCCAGTCCTGG + Intronic
1188846324 X:35076730-35076752 TGAAGGGAAGAACCCATTCCTGG - Intergenic
1188897425 X:35686388-35686410 GGAAGGGAAGAACCCAATCCAGG + Intergenic
1188917897 X:35934787-35934809 TGAAGGGAAGGATCCAATCCTGG - Intronic
1188924649 X:36024165-36024187 TGAAGGGGAGAACTCAGTCCTGG - Intergenic
1188943083 X:36263988-36264010 TGGAGGGAAGGACACAGTCCTGG - Intronic
1188970804 X:36613177-36613199 TGAATGCCAGAAACAAGTCCTGG - Intergenic
1189013479 X:37071115-37071137 TGAAGGGAAGAACCCAGTCTTGG - Intergenic
1189019573 X:37320257-37320279 TGAAGGAAAAGACCCAGTCCTGG + Intergenic
1189405695 X:40720915-40720937 TGAAGGAAAGGACCCAGCCCTGG + Intronic
1189411912 X:40780017-40780039 TGCAGAGAAGAACCCAGTCCTGG - Intergenic
1189593817 X:42543383-42543405 TGAAGGGAAGAAACAAGTCCTGG + Intergenic
1189640731 X:43068017-43068039 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1189658028 X:43267452-43267474 TGAAGGGATGGATCCAGTCCTGG - Intergenic
1189769981 X:44416255-44416277 TGAAGGGAAGAACATAGGCCTGG - Intergenic
1189770089 X:44416907-44416929 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1189854438 X:45209653-45209675 TGAAAGGAAGAACCCAGTCCAGG - Intergenic
1189874372 X:45420594-45420616 TGAAAGGATAAACCCAGTCCTGG - Intergenic
1190046221 X:47113390-47113412 TGAAGGGAAGGCTCTAGTCCTGG + Intergenic
1190122375 X:47672668-47672690 TGAAGGGAAGGATCCAGTCCTGG - Intergenic
1190374375 X:49774865-49774887 TGAAGAGAAGAACCCAGTTCTGG - Intergenic
1190530366 X:51368675-51368697 TGAAGAAAAGGACCCAGTCCTGG + Intergenic
1190537785 X:51446840-51446862 TGAAGGGAAGAATCTAGTCCTGG - Intergenic
1190569853 X:51770032-51770054 TGAAGGGAAGCTCAAAGTCTGGG - Intergenic
1190602671 X:52108548-52108570 TGAAGGGAAGGACCAACTCCTGG - Intergenic
1190614562 X:52217211-52217233 TGAAGGGAAGGATCCAGTCCTGG + Intergenic
1190893912 X:54597267-54597289 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
1190907920 X:54746604-54746626 TGAAGGGAAGGACCCAGTTGTGG - Intergenic
1190919586 X:54839503-54839525 TGAAGGGAAGGACCCATTCCTGG - Intergenic
1191059364 X:56278377-56278399 TGAAGAGAAGAACCCAGTTCTGG - Intronic
1191079969 X:56499479-56499501 TGAAAGCTAGAACCCAGTCCTGG + Intergenic
1191197126 X:57736599-57736621 TAAAGGGAAGGACCCAGTCCTGG + Intergenic
1191593243 X:62912428-62912450 TGAAGGAAAGGACCCAGTCCAGG - Intergenic
1191812416 X:65203456-65203478 TGAAGAAAAGGACCCAGTCCTGG - Intergenic
1191829576 X:65401856-65401878 TGAAGGGAAGGAGCCAGTCTTGG + Intronic
1191829655 X:65402399-65402421 TGAAGGGAAGGACACAGGCCTGG + Intronic
1191834146 X:65446075-65446097 TGAAGGAAAGAACCCAGTCCTGG - Intronic
1191924562 X:66295846-66295868 TGAAGGGAAGGACCTGGTTCTGG - Intergenic
1191972486 X:66832464-66832486 TGAAGGCAAGGACCCAGTCTAGG + Intergenic
1191984016 X:66959383-66959405 TAAAGGGAAGAACACAGGCCTGG - Intergenic
1191986385 X:66985655-66985677 TGAAGGAAAAGACCCAGTCCTGG - Intergenic
1192060181 X:67816605-67816627 TGAAGGGAAGAACCCAGTCCTGG + Intergenic
1192062136 X:67838650-67838672 TGAACGGAAAGACCCAGTCCTGG + Intergenic
1192077847 X:68018309-68018331 TGAAGGGAAGAACCCAGTCCTGG + Intergenic
1192077956 X:68018975-68018997 TGAAGGGAAGAACACAGGCCCGG + Intergenic
1192088130 X:68121942-68121964 TGAATGGAAGAACCCAGTCCTGG + Intronic
1192374849 X:70549182-70549204 TGAAGGGAAGGACCCAGTCTCGG + Intronic
1192380776 X:70613961-70613983 TGAAGGGAAGGACCCAGTCCCGG + Intronic
1192393321 X:70753512-70753534 TGAAGGGAAGGACCCAGTTCTGG + Intronic
1192393487 X:70754534-70754556 TGAAGGGAAGAACACAGGCCTGG + Intronic
1192400214 X:70827187-70827209 TGAAGGAAAGGATCCAGTCCTGG + Intronic
1192505561 X:71680081-71680103 TGAAGGGAAGGACAAAGGCCTGG - Intergenic
1192640462 X:72857276-72857298 TGAAGGGAAGGAACCAGTCTTGG + Intergenic
1192641249 X:72863500-72863522 TGAAGGGAAGGAACCAGTCTTGG - Intergenic
1192700743 X:73468831-73468853 TGGAGAGAAGTACCCAGTCCTGG - Intergenic
1192714690 X:73627367-73627389 TGAAGGGAAGGACATAGGCCTGG - Intronic
1192714792 X:73628019-73628041 TGAAGGAAAGGACCAAGTCCTGG - Intronic
1192793374 X:74406187-74406209 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1192836095 X:74801500-74801522 TGAAAGGAAGAACCCAGTCCTGG + Intronic
1192841157 X:74857434-74857456 TCAAGGGAAGGACCTGGTCCTGG + Intronic
1192858525 X:75040120-75040142 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1192872656 X:75199439-75199461 TGAAGGGAAAGACCCAGTCCTGG + Intergenic
1192908476 X:75578386-75578408 TGAAAGGAAGGACACAGTCCAGG - Intergenic
1192958823 X:76104397-76104419 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
1192977941 X:76306307-76306329 TGAAAGGAAGAACAAAGGCCTGG - Intergenic
1193052426 X:77115498-77115520 TGAAGGAAAGGACCTAGTTCTGG - Intergenic
1193063561 X:77233177-77233199 TGAAAGGAAGAACACAGTCCTGG + Intergenic
1193098406 X:77579225-77579247 TGAAGGGAAAGACCCAGTACTGG + Intronic
1193147526 X:78092820-78092842 TGAAGGAAACGACCCAGTCCTGG - Intronic
1193169031 X:78315182-78315204 TGAAGGGAAGGACCTAGTCCTGG + Intronic
1193173056 X:78358630-78358652 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
1193184984 X:78501524-78501546 TGAAGGAATGAACCTAGTCCTGG + Intergenic
1193280364 X:79641646-79641668 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1193417049 X:81238011-81238033 TGAAGGGAAGGACCCAATCTTGG + Intronic
1193463519 X:81818325-81818347 TGAAGGGAACAACCCAGTCCTGG - Intergenic
1193504981 X:82330860-82330882 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1193555799 X:82952110-82952132 TGAAGGGAAAGACCCAGTCCTGG - Intergenic
1193563400 X:83047772-83047794 TGAAGGAAAGAACACAGTTCTGG - Intergenic
1193585053 X:83311181-83311203 TGAAGGGAAGGAACCAGTCCTGG + Intergenic
1193596441 X:83451668-83451690 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1193650285 X:84123114-84123136 TGAAGAGAAGAACCCAGTCCTGG + Intronic
1193658248 X:84224678-84224700 TGAAGGGAAGGACCCAGTTCTGG - Intergenic
1193664557 X:84299999-84300021 TGAAAGGAAGGACCCAGTCCTGG + Intergenic
1193664675 X:84300666-84300688 TGAAGGGAAGGACACAGTCCTGG + Intergenic
1193665392 X:84309900-84309922 TGTAGGAAAGAACCCAGTCCTGG + Intergenic
1193692795 X:84668049-84668071 TGAAGGGAAGGACCCAGTTCTGG + Intergenic
1193738256 X:85186045-85186067 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
1193742320 X:85232203-85232225 TAAAGGGAAGAACCCAGTCCTGG + Intergenic
1193755820 X:85407978-85408000 TGAAGGGAAGGACATAGGCCTGG - Intergenic
1193755926 X:85408646-85408668 TGAAGGGAAGGAGCCTGTCCTGG - Intergenic
1193756797 X:85418812-85418834 TGAAGGGAAGAACTTAGTCCTGG - Intergenic
1193760733 X:85462474-85462496 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1193830966 X:86289109-86289131 TGAAGGGAATGACCAAGACCTGG - Intronic
1193856748 X:86612079-86612101 TGAAGGGAAGGACTCTGTCCTGG - Intronic
1193880173 X:86911556-86911578 TGAAGGAAAGGACCCAGTACTGG - Intergenic
1193894836 X:87100393-87100415 TGAAGGGAAGGACCCAGTCTTGG + Intergenic
1193899650 X:87161649-87161671 TGAAGTGAAGGACCTAGTACTGG - Intergenic
1193917096 X:87378938-87378960 TGAAGAGAAGGATCCAGTCCTGG + Intergenic
1193980915 X:88180845-88180867 TGAAGGGAAGAAACCAGTCCTGG - Intergenic
1193981620 X:88187790-88187812 TAAAGGGAAGGACCGAGTCCTGG + Intergenic
1194065260 X:89253164-89253186 TGAAGGGAAGGAACCAGTCCTGG + Intergenic
1194095731 X:89636566-89636588 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
1194112720 X:89854643-89854665 TGAAGGGAAAGACAAAGGCCTGG + Intergenic
1194136614 X:90151831-90151853 TGAAGGGAAAGACCCAGTTCTGG + Intergenic
1194189342 X:90815918-90815940 TGAAGGGAAAGACACAGTCCTGG + Intergenic
1194229647 X:91306612-91306634 TGAAGGGAAGAACACAAGCCTGG - Intergenic
1194253149 X:91602902-91602924 TTAAGGGAAGGACCCAGTCCTGG + Intergenic
1194264976 X:91742934-91742956 TGAAGGGAAAAACACAGGCCTGG - Intergenic
1194282981 X:91975610-91975632 AGAAGGGAAGAAACTAGTCAAGG + Intronic
1194320054 X:92435073-92435095 AGAATGGCAAAACCAAGTCCAGG + Intronic
1194329203 X:92560227-92560249 TGAAGGGAAGGAACCAGTTCTGG + Intronic
1194340683 X:92701171-92701193 TGAAGGGAAGAACCAAGTCCTGG - Intergenic
1194370822 X:93069494-93069516 TGAAGGGGAGTACCTAGTCTTGG + Intergenic
1194396722 X:93395459-93395481 TGAAGCAAAGGACCCAGTCCTGG - Intergenic
1194415454 X:93606323-93606345 TGAAGGGAAGAACCCATTCCTGG + Intergenic
1194457603 X:94123994-94124016 TGAAGGGAAGAACCTAGTCCTGG - Intergenic
1194492367 X:94567878-94567900 TGAAGTGAAAAACCAAGCCTTGG - Intergenic
1194550395 X:95291088-95291110 TGAAGGAAAGAACCCTGTCCTGG + Intergenic
1194558235 X:95388956-95388978 TGAAGGGTAGGAACTAGTCCTGG - Intergenic
1194558588 X:95393456-95393478 TGAAGGGAAGGACCTAGTCATGG + Intergenic
1194591511 X:95805288-95805310 TGAAGGGAAGAAGACAGTTCTGG + Intergenic
1194595237 X:95848724-95848746 TGAAGGGAAGGACATAGGCCTGG + Intergenic
1194626303 X:96230083-96230105 TGAAGGAAAGGACCCAATCCTGG + Intergenic
1194719757 X:97326472-97326494 TGAAAGCAAGCCCCAAGTCCCGG - Intronic
1194787644 X:98106402-98106424 TGAAAAGAAGGACCCAGTCCTGG - Intergenic
1194788695 X:98118820-98118842 TGAAGGAAAGGATCCAGTCCTGG + Intergenic
1194841996 X:98754236-98754258 TGAAGAGAAGTACCCAGTCCTGG - Intergenic
1194882760 X:99274080-99274102 TGATAGGAAGGACCCAGTCCTGG + Intergenic
1194920866 X:99761879-99761901 TGAAGGGTAGAACACAGGCCTGG + Intergenic
1194928783 X:99861945-99861967 TGGAAGGAAGAACCCAGTCCTGG + Intergenic
1194937657 X:99970558-99970580 TGAAGGGAAAGACCCAGTCCTGG - Intergenic
1195014691 X:100766562-100766584 TAAAGGGAAGGACCCACTCCTGG - Intergenic
1195037046 X:100980160-100980182 TGAAGGGAAATACCCTGTCCTGG - Intronic
1195115722 X:101696273-101696295 TGAAGGGAAGGACCCTGTCCTGG + Intergenic
1195115848 X:101696941-101696963 TGAAGGGAAGGACACAATCCTGG + Intergenic
1195132197 X:101864040-101864062 TGAAGGGAAGAACACAGGCCTGG + Intergenic
1195172312 X:102281422-102281444 TGAAGGAAAGGACCTAGTCCTGG - Intergenic
1195186548 X:102405671-102405693 TGAAGGAAAGGACCTAGTCCTGG + Intronic
1195199324 X:102532711-102532733 TGAAGGGAAGGACCCAGCCCTGG + Intergenic
1195312255 X:103643176-103643198 TGAAGGGAAGGGCCCAATCCTGG + Intergenic
1195396131 X:104412255-104412277 TGAATGGAAGGACCCAGTCCTGG + Intergenic
1195477360 X:105302470-105302492 TGAAGGGAAGAACCAAGTCCTGG - Intronic
1195502060 X:105613246-105613268 TGAAGGGAAGGACACGGTCCAGG + Intronic
1195543345 X:106087696-106087718 TGAAGGAAAAAACCCAATCCTGG - Intergenic
1195601310 X:106751791-106751813 TGAAGGAAAGGACCCAGTTCTGG + Intronic
1195783071 X:108485534-108485556 TGAAGAGAAGGGCCAAGTCCTGG - Intronic
1195807867 X:108795867-108795889 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
1195821208 X:108946877-108946899 TGGAGGAAAGGACCAAGTCCTGG - Intergenic
1195823301 X:108970327-108970349 TGAAGGAAAAGACCCAGTCCTGG + Intergenic
1195849170 X:109264530-109264552 CGAAGGGAAGAACCCAGTCCTGG - Intergenic
1195852182 X:109295322-109295344 TGAAGGGAAGGACCAAGTCCTGG - Intergenic
1195872125 X:109497593-109497615 TGAAGGGAAGGACCCAGTCTGGG - Intergenic
1195984586 X:110615184-110615206 TGAAGGGAAGAACCCAGTCATGG - Intergenic
1196096784 X:111808876-111808898 TGAAGGGAAGGACTCAGTTCTGG - Intronic
1196154003 X:112406922-112406944 TGAAGGGAAGGACCCAGTTCTGG + Intergenic
1196214532 X:113035288-113035310 TAAAGAGAAGAACCAAACCCTGG - Intergenic
1196232491 X:113240242-113240264 TGAAGGAAAACACCCAGTCCTGG - Intergenic
1196234477 X:113262457-113262479 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
1196270095 X:113699861-113699883 TGAAGAGAAGGACCCAGTCCTGG - Intergenic
1196304620 X:114086953-114086975 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1196357208 X:114809058-114809080 TGAAGGGAAGGACACAGGCCTGG - Intronic
1196357376 X:114810003-114810025 TGAAGGGCAGGACCAAGTCCTGG - Intronic
1196399557 X:115299916-115299938 TGAAGGAAAGGACCCAGCCCTGG - Intronic
1196466163 X:115973370-115973392 TGAAGGTAAGAATCCAGTCCTGG + Intergenic
1196467788 X:115990999-115991021 TGAAGAAAAGGACCCAGTCCTGG + Intergenic
1196494281 X:116306488-116306510 TGAAAGGAAGAACTCAGTCCAGG - Intergenic
1196494385 X:116307158-116307180 TGAAGGGAAGTACCCAGTTCTGG - Intergenic
1196495333 X:116317958-116317980 TAAAGGGAAGGACCAAGTCCTGG + Intergenic
1196508694 X:116479219-116479241 TGAAGGGAAGGATCTAGTCCTGG + Intergenic
1196517574 X:116631241-116631263 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
1196535451 X:116838424-116838446 TAAAGGGAAGAAAACAGTCCTGG - Intergenic
1196564468 X:117188902-117188924 TGGAGGTAAGAATCCAGTCCTGG + Intergenic
1196579094 X:117358818-117358840 TGAAGGGAAGAATACAGGCCTGG - Intergenic
1196591081 X:117485688-117485710 TGAAGGAAAGAACCCAGTCCTGG - Intergenic
1196660508 X:118264212-118264234 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1196922098 X:120594984-120595006 TGAAGGAAAGGATCCAGTCCTGG + Intronic
1196962146 X:121014800-121014822 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
1196980622 X:121209477-121209499 TGACAGGAAGCACCCAGTCCTGG - Intergenic
1196984567 X:121254024-121254046 TGAAGGAAAGGACCCAGTCCTGG - Intergenic
1197011568 X:121570526-121570548 TGAAGGGAAGGACCCAGTCTGGG + Intergenic
1197052594 X:122077647-122077669 TGAAAGGAAGGACCCAGTGCTGG - Intergenic
1197053878 X:122094041-122094063 TGAAGGGAAGGACCTAGTCCTGG + Intergenic
1197072900 X:122321938-122321960 TGAAGGGAAGGACCCAATCCTGG + Intergenic
1197075715 X:122350430-122350452 TAAAGGGAAGGACCCAGTCCTGG + Intergenic
1197078221 X:122378481-122378503 TTAAGGTAAGAACCCAGTTCTGG - Intergenic
1197096658 X:122604401-122604423 TGAAGGAAAGAACCTAGTCGTGG + Intergenic
1197139204 X:123097265-123097287 TGAAGGGAAGGACACAGTCCTGG + Intergenic
1197348253 X:125350444-125350466 TGAAGGGAAAAACCCAGTCCTGG + Intergenic
1197363229 X:125532951-125532973 GGAAGGGAAGAACTCAGTCTTGG - Intergenic
1197375965 X:125682317-125682339 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1197380853 X:125736953-125736975 TAAAGGGAAGAACCCAGTCCTGG - Intergenic
1197391042 X:125865129-125865151 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1197391834 X:125877448-125877470 TGAAGGGAAAAACAAAGGCCTGG - Intergenic
1197399671 X:125974650-125974672 TGAAGGGAAAAATAAATTCCTGG + Intergenic
1197435673 X:126425381-126425403 TGAAGGGAAGGACCTAGTCCTGG - Intergenic
1197439306 X:126470848-126470870 TGAAAGGAAGGACGCAGTCCTGG + Intergenic
1197457960 X:126701524-126701546 TGAAAGGAAGGAACTAGTCCTGG + Intergenic
1197470078 X:126856200-126856222 TGAAGGGAAGAACACAGGCCTGG + Intergenic
1197502605 X:127260323-127260345 TGAAGGAAAGGACCCAGTCCTGG + Intergenic
1197561893 X:128034318-128034340 TGAAAGGAAGGACCCAGTCCTGG + Intergenic
1197581356 X:128288169-128288191 TGAAGGGAAGTACCCAGTCCTGG + Intergenic
1197602651 X:128548296-128548318 TAAAGGGAAAGACCCAGTCCTGG - Intergenic
1197810873 X:130441913-130441935 TGAAGGGAAGGACCCAGTCATGG - Intergenic
1197953123 X:131918962-131918984 TGAAGAGAAAAACTCAGTCCTGG + Intergenic
1198292990 X:135256953-135256975 TGAAGGAAAGGACCCAGTCCTGG + Intronic
1198430847 X:136564948-136564970 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1198515285 X:137400763-137400785 TGAAAGGAAGAACCCAGTCCTGG - Intergenic
1198586080 X:138123976-138123998 TGGAGGAAAGGACCCAGTCCTGG - Intergenic
1198611954 X:138411549-138411571 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1198694851 X:139324869-139324891 TGAAGGAAAGGATCCAGTCCTGG + Intergenic
1198702485 X:139413331-139413353 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1198702596 X:139414001-139414023 TGAAGGGAAGGACTCAGTCCTGG - Intergenic
1198785502 X:140283578-140283600 TGAAGGGAAGGAACCAGTCCTGG - Intergenic
1198788167 X:140313758-140313780 TGAAGGGAAGAACCCAGTCCTGG + Intergenic
1198817985 X:140613914-140613936 TGAAGGGAAAAACACAGGCCTGG - Intergenic
1198818098 X:140614572-140614594 TGAAGGAAAGGGCCCAGTCCTGG - Intergenic
1198862874 X:141089322-141089344 TGAAGGAAAGAATGCAGTCCTGG + Intergenic
1198899819 X:141498067-141498089 TGAAGGAAAGAATGCAGTCCTGG - Intergenic
1198938940 X:141931675-141931697 TGAAGTGAAGGACACAGTCCTGG - Intergenic
1198995251 X:142566961-142566983 TGAAGGGAAGAACCCAGTCCTGG - Intergenic
1199005697 X:142693651-142693673 TGATGGAAAGGACCAAGTCCTGG + Intergenic
1199032215 X:143013790-143013812 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1199041112 X:143116378-143116400 TGAATGGGAGAAACCAGTCCTGG - Intergenic
1199050656 X:143232863-143232885 TGAAGGAAAGGACCCAGGCCTGG + Intergenic
1199058699 X:143328271-143328293 TGAAGGAAAGGACCTAGTCTTGG + Intergenic
1199115237 X:143984813-143984835 TGAAGGGATGGACCCAATCCTGG - Intergenic
1199138922 X:144287373-144287395 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1199144750 X:144351423-144351445 TGAAGGGAAGGACACAGGCCAGG - Intergenic
1199156119 X:144550939-144550961 TGAAGGGAAGGACCCAGACAGGG + Intergenic
1199159946 X:144597188-144597210 TAAAGGGAAGGACCCAGTCCTGG - Intergenic
1199197459 X:145048062-145048084 TGAAGGGAAGAACCCAGTCTTGG + Intergenic
1199223129 X:145340285-145340307 TGAAGGGAAGGAATGAGTCCTGG + Intergenic
1199239117 X:145526171-145526193 TGAAGGGAAGTACCCAGTCTTGG + Intergenic
1199247648 X:145625404-145625426 TGAGGGGAAGGACCTAGTTCTGG + Intergenic
1199258527 X:145744642-145744664 TGAAGGAAAGGACCCAGCCCTGG + Intergenic
1199303911 X:146244938-146244960 TGAAGGGAAGAACCCAGTACTGG + Intergenic
1199308611 X:146297050-146297072 TGAAGGGAAGGACATAGGCCTGG - Intergenic
1199308708 X:146297717-146297739 TGAAGGAAAGAACCCAGCCATGG - Intergenic
1199314738 X:146363542-146363564 TGAAGGGAAGGACCTAGTCCTGG - Intergenic
1199316051 X:146379431-146379453 TGAAGGGAAGGGCCCAGTCCCGG + Intergenic
1199334254 X:146600145-146600167 TGAAGGGAAGAACACAGGCCTGG - Intergenic
1199374159 X:147087948-147087970 TGAAGGGAAGGACACAGGCCTGG - Intergenic
1199374281 X:147088641-147088663 TGAAGGAGAAGACCAAGTCCTGG - Intergenic
1199415192 X:147573990-147574012 TGAAGGGAATGACCCAGTCCTGG + Intergenic
1199439678 X:147854336-147854358 TGAAGGGAAGGACCTAGTGCTGG - Intergenic
1199440939 X:147867064-147867086 TGAAGGGAAAAACCCAGCCCTGG + Intergenic
1199485067 X:148338320-148338342 TGAAGGGAAGGACCCAGTCCTGG + Intergenic
1199645726 X:149909150-149909172 TGAAGGGAAGTATCCAGTTCAGG + Intergenic
1199729246 X:150614815-150614837 TTAAGGGAAGAACCATTTCCAGG - Intronic
1199795489 X:151191639-151191661 TGAATGGAACGACCCAGTCCTGG + Intergenic
1199845240 X:151688123-151688145 TGAAAGGAAGGACCCAGTCCTGG + Intergenic
1199921221 X:152405740-152405762 TGAAAGGAAGGACCCAGTCCTGG + Intronic
1200315852 X:155132542-155132564 TGAAGGGAAGAATCCAGTTTTGG + Intronic
1200364305 X:155645062-155645084 TGAAGAGAAGGACCCAGTCCTGG - Intronic
1200370015 X:155715301-155715323 TGAAGGGAAGGACCCAGTCCTGG - Intergenic
1200370498 X:155719744-155719766 TCAAGGGAAGGACCCAGTCCTGG + Intergenic
1200379509 X:155819969-155819991 TGAAGAGAAAGACCCAGTCCTGG + Intergenic
1200448733 Y:3297938-3297960 TGAAGAGAAGGACCCAGTCCTGG + Intergenic
1200465373 Y:3509454-3509476 TGAAGGGAAAGACAAAGGCCTGG + Intergenic
1200482365 Y:3721781-3721803 TGAAGGGAAAGACCCAGTTCTGG + Intergenic
1200535921 Y:4397811-4397833 TGAAGGGAAAGACACAGTCCTGG + Intergenic
1200572089 Y:4844145-4844167 TTTAGGGAAGGACCCAGTCCTGG + Intergenic
1200582126 Y:4963380-4963402 TGAAGGGAAAAACACAGGCCTGG - Intergenic
1200600562 Y:5200145-5200167 AGAAGGGAAGAAACTAGTCAAGG + Intronic
1200603170 Y:5231708-5231730 TGAAGGGAAGAACATAGGCTTGG - Intronic
1200637904 Y:5679416-5679438 TGAAGGGAAGGAACCAGTTCTGG + Intronic
1200649038 Y:5817909-5817931 TGAAGGGAAGAACCAAGTCCTGG - Intergenic
1200678617 Y:6181386-6181408 TGAAGGGGAGTACCTAGTCTTGG + Intergenic
1200719431 Y:6587248-6587270 TGAAGGGAAGGAACCAGTCCTGG + Intergenic
1201762388 Y:17554713-17554735 TGAAGGAAAGAACCCAGTGCTGG + Intergenic
1201839164 Y:18351275-18351297 TGAAGGAAAGAACCCAGTGCTGG - Intergenic
1202023328 Y:20491581-20491603 TCAAGGGAAGAACCCATTCCTGG + Intergenic
1202042714 Y:20701855-20701877 TGAAGGGAAGGACCCAGTACTGG + Intergenic
1202595513 Y:26535121-26535143 TGAAGGGAAGGACACAGACCTGG + Intergenic