ID: 1200649041

View in Genome Browser
Species Human (GRCh38)
Location Y:5817925-5817947
Sequence AGAAAACCTGCTGCCTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200649041_1200649047 22 Left 1200649041 Y:5817925-5817947 CCCTTCAAGGCAGCAGGTTTTCT No data
Right 1200649047 Y:5817970-5817992 AATGTCCAGGATCTAGGGCCTGG No data
1200649041_1200649049 27 Left 1200649041 Y:5817925-5817947 CCCTTCAAGGCAGCAGGTTTTCT No data
Right 1200649049 Y:5817975-5817997 CCAGGATCTAGGGCCTGGAATGG No data
1200649041_1200649045 16 Left 1200649041 Y:5817925-5817947 CCCTTCAAGGCAGCAGGTTTTCT No data
Right 1200649045 Y:5817964-5817986 TCTAGAAATGTCCAGGATCTAGG No data
1200649041_1200649050 28 Left 1200649041 Y:5817925-5817947 CCCTTCAAGGCAGCAGGTTTTCT No data
Right 1200649050 Y:5817976-5817998 CAGGATCTAGGGCCTGGAATGGG No data
1200649041_1200649046 17 Left 1200649041 Y:5817925-5817947 CCCTTCAAGGCAGCAGGTTTTCT No data
Right 1200649046 Y:5817965-5817987 CTAGAAATGTCCAGGATCTAGGG No data
1200649041_1200649044 9 Left 1200649041 Y:5817925-5817947 CCCTTCAAGGCAGCAGGTTTTCT No data
Right 1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200649041 Original CRISPR AGAAAACCTGCTGCCTTGAA GGG (reversed) Intergenic
No off target data available for this crispr