ID: 1200649043

View in Genome Browser
Species Human (GRCh38)
Location Y:5817954-5817976
Sequence GGACATTTCTAGAAACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200649043_1200649049 -2 Left 1200649043 Y:5817954-5817976 CCAGTGTGTTTCTAGAAATGTCC No data
Right 1200649049 Y:5817975-5817997 CCAGGATCTAGGGCCTGGAATGG No data
1200649043_1200649050 -1 Left 1200649043 Y:5817954-5817976 CCAGTGTGTTTCTAGAAATGTCC No data
Right 1200649050 Y:5817976-5817998 CAGGATCTAGGGCCTGGAATGGG No data
1200649043_1200649047 -7 Left 1200649043 Y:5817954-5817976 CCAGTGTGTTTCTAGAAATGTCC No data
Right 1200649047 Y:5817970-5817992 AATGTCCAGGATCTAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200649043 Original CRISPR GGACATTTCTAGAAACACAC TGG (reversed) Intergenic
No off target data available for this crispr